( or The End of the Beginning . . . )
( or The End of the Beginning . . . )
Episode 51, "ANNIHILATION / ANNIHILATION"
A&R
PART III
"If you must kill me, kill me softly/ Anamnesis."
-----------------------------------------------------------------------
Music: Adagio, by Samuel Barber
-----------------------------------------------------------------------
(CAPTIONS)
Aoi: No, it is wrong . . . I can’t!!
Asuka: You know it in your heart to be true—you are not one of them . . .
Aoi: But---But I am!
Shinji: fake. You are a false thing if you believe this is so.
Aoi: No . . .
Rei: Natus De Adamo, Malachi . . .
Aoi: Please . . .
Rei: Natus De Eva, Tamashii. . .
Lyn: You are denying that which forms yourself, girl.
Aoi: No! Please . . . !
Don’t make me do this . . .
not to the ones I love . . !
-----------------------------------------------------------------------
Seele: For all our waiting, the time at last comes.
Seele: Our moment . . .
Seele: Your moment . . .
Kihl: The army stands at the ready. All that remains is the soul.
Seele: The one who is to facilitate contact
Seele: She . . .
Seele: The time is close . . .
Seele: We must now wait, while the last remaining traces of resistance are crushed.
Seele: Yes--
Seele: The four horsemen must be broken . . .
Seele: . . . and the horses made lame . . .
Seele: The holy apocalypse, the predestined ascension . . . must
be
ours alone to control.
Seele: Foreseen within the Dead sea scrolls . . .
Seele: Our plan . .
Seele: Our causal chain . ..
Kihl: Will at last come to its end . . .
Seele: We prepare now, for Death . . .
Seele: And with Death, must come Rebirth . . .
UNSynaps: A return . . .
-----------------------------------------------------------------------
(Far from the Northern District of Tokyo 3 . . .in
the small collection of houses in the lower
eastern sector of the city . . .
Aoi Tamashii stands at her window, staring vapidly into the torrent outside.
The last vestiges of laughing girlhood now totally
drained from her young frame, The child’s
azure eyes are empty and lifeless—
--yet they are also somewhat red . . .
it would seem that for some time, she has been crying . . .
For the moment, however, not a sound escapes her
lips, as the tempest outside continues its
merciless downpour on the other side of her window. Behind her
is a vacant, dreary room; shrouded
in almost complete darkness, save for what little light streams in
through the window. Indeed, the sheer
desolation of the house seems to mirror the hollowness of the girl’s
emotion with terribly morose accuracy.
Devoid of any furniture or, for that matter, any other form of worldly
comfort, the empty confines seem to
shudder continuously with the sound of a million fingers tapping on
its roof, as Aoi gazes thoughtlessly through
glazed-over eyes into the falling rain . . .
In time, Tamashii finally moves—pressing cold fingers to the frigid glass separating her from the world beyond . . . )
Aoi: (Thinking) How like tears . . .
(Slowly, that same hand moves from the glass, to the girl’s own face—pressing gently against her eyelids . . .)
Aoi: I . . . I can’t do this . . .
Aoi: . . .
Aoi: (Thinking) I must fail . . .
(She sighs, swallowing hard
. . .)
Aoi: (Thinking) But I do not want to die . . .
(Taking a step back, Aoi removes her hand, opening her eyes once more . . .)
Aoi: (Thinking) I now . . . know what this is . . .
I now know this feeling . . .
I can feel . . .
Like those of clay, I can feel!
I have learned the glory of his love . . .
of pain . . .
Aoi: (Thinking) I wish you were still here, brother . . .
to Guide me . . .
(for an instant, lightning crashes outside—bathing
the entire room in an ghostly, blue light . . .
With trembling hands, the girl brushes her bangs aside—digging her
fingers into her cheek as the
tears begin to form at the corners of her eyes once more . . . it is
then that she whispers to herself again, a
hollow desparation apparent in her voice . . . )
Aoi: Why does this have to happen!?
Aoi: Is this . . Is this why I was brought into being?
Aoi: Is this why I was allowed to see into them?
Aoi: Is . . is this why I was given their shape?!
(as she utters this, the girl does not take
her eyes from the window . . .)
Aoi: to bring suffering?
Aoi: . . .
Aoi: to bring pain?
Aoi: Torment and death?
Aoi: Was this my whole purpose for coming?!
Aoi: To betray the trust of those that love me?
(Aoi falls silent, seemingly, waiting for an answer . . .
But then, Suddenly, she clenches her hands into fists—shrieking at the thunderstorm outside. . .)
Aoi: I DON’T WANT TO!!
Aoi: I DON’T!!
Aoi: I CAN’T DO THIS!!!
Aoi: They have paid enough!!! They don’t deserve this!
Aoi: PLEASE!!!
Aoi: There has to be another way . . .
Aoi: Please . . . please . . . Don’t make me do this .!
Aoi: To hurt them like this . . .
Aoi: Fragile and innocent creatures, T-they’ve been tormented enough . . .
Aoi: Please, please, please!!
Aoi: Don’t make me do this!!
Aoi: Don’t make me do this to the ones I love . . .!
(Slowly, Tamashii sinks to her knees, succumbing. . .)
Aoi: (crying) I didn’t want to . . . I had control . .
Aoi: . . .I could have lived among them forever . . .
. . . lived with . . .with
him . . .
Aoi: Why did they have to bring it back . . ?!
(The girl presses her palms to the floor, shutting her eyes --)
Aoi: (Thinking) And . . and now . .I have no choice . . .I-- I must
aide the demon that has brought me to
this end!!
Aoi: H-Humanity must die . . . and I-I must be the H-harbinger of that death . . .
Aoi: N-No choice . . .
Aoi: No . .choice . . .!
Aoi: No choice . . .
Aoi: A . . .A Part of me is dead now . . .
Aoi: Asuka . . Ikari . . .
Aoi: Anouilh . . .
Aoi: Ayanami . . .
Aoi: (Shuddering) Oh . . . Rei . . .no . . .
(Now completely drained, the girl sinks to the floor—her bright blue school uniform crumpling about her shape, as it is shaken by sobs of now quiet lamentation. . .)
Aoi: I’m sorry, Lyn . .
Aoi: N--Nagisa, forgive me . . .
(Gasping, the girl pounds the cold floorboards with her fist,
trying to deny that which she knows is her . . .)
Aoi: All of you . . . please forgive me . .for the terrible things
I must do . . .
-----------------------------------------------------------------------
(Hours later . . . as the storm finally ends, and the sun rises from behind the mist-enshrouded peaks of the surrounding mountains, light pours into the open vents of the Geo-front ceiling, washing into the interior. As the sheltered trees and grass take in much needed morning sun, and birds awaken with the cries of summer, the world at last begins to stir . . .)
-----------------------------------------------------------------------
(Far below, on the surface of the Geo-front interior, Shinji Ikari awakens to find himself lying among the Watermelons of Kaji’s Garden. . .As the boy rises, his senses detect the freshness in the morning air, and the coolness of it against his skin . . .
. . . this does little to rouse his vigor, however, as he has not forgotten his troubles, even in slumber.
Slowly, the boy begins to stand—squinting his eyes at the morning brightness. As he pulls his hand away, he stands there for a moment, gazing at the small, oblique shapes of the watermelon patch. . .
finally, he untwists one of the numerous vines from around his leg, and walking through the garden . . .)
Shinji: More unpleasantness . . . so I run away . . .
(oddly, he soon comes to a stop—kneeling among
the rows of fruit--)
Shinji: Kaji, what would you think of me?
Shinji: (thinking) You once said our Kanji for female was "A woman
far away." . . .She is far away from
me now . . . Too far to reach . . .What should I do?
(Unfortunately, there is no one to answer the
boy’s question—only the ambient noise of the outdoors can be heard, interrupted
occasionally by the rumble of the access-trains far above, suspended among
the hanging spires of Tokyo 3 . . .
Provided with no answer, the boy stands—
--and finds his own . . .)
Shinji: . . I should go back to Misato . . .
-----------------------------------------------------------------------
Misato: Asuka? Asuka, are you awake?
(Meanwhile—in the apartment of Misato Katsuragi . . .)
Misato: Hey—I’ve got something to tell you . . .
(The woman stands at the door to Asuka Soryu’s room, still dressed in sleeping clothes, knocking sharply as she calls--)
Misato: Asuka, there’s someone here I have to talk to you about . . .
(Silence . . .)
Misato: Okay, I’m coming in . . .
(fumbling with the doorhandle, she slides it open . . .
revealing an empty room beyond . . .)
Misato: Asuka?
(There is no answer, however. And, as Misato looks inside, she finds the bed, though somewhat unkempt, is still made . . . the rest of the room, meanwhile, is a shambles . . .)
Misato: You didn’t come home last night . . . and I didn’t even notice . . .
(The woman closes the door, dropping her eyes to her feet. Tangled locks of hair fall about her shoulders as she makes her way wearily through the hallway, to the bathroom . . .)
Misato: I need a shower . . .
(Meanwhile, As Katsuragi passes the open door of the next room—the child known as "Tenkei" is visible, sleeping curled up on Shinji Ikari’s bed. . .
The boy remains sedate and tranquil, unstirring
as Misato walks by . . .)
-----------------------------------------------------------------------
(Meanwhile, in the apartment two stories up . . .)
Lyn: No thanks . . . you know I don’t drink coffee . . .
Seyoko: Then tell me what’s on your mind, kid . . . that’s what I’m here for.
Lyn: (closing his eyes) I thought you were here to "keep an eye on the drones . . ."
(Sitting at the breakfast table across from
the 7th child, Lyn Anouilh, Seyoko Okazaki looks up from her
coffee, eyeing the boy--)
Seyoko: What, I’m not allowed to get angry?
Lyn: No, I . . I just think you’re not being fair . . .
Seyoko: Oh, please.
Lyn: I don’t see why you have to give Major Katsuragi such a hard time—
Seyoko: (interrupting) "Hard Time?" Whose side are you on, anyway?!
Lyn: I’m not on anyone’s side, I’m just saying—
(The woman stands, leaning over the table and glaring at the boy--)
Seyoko: I don’t want to hear it! What made you so opinionated, anyway?
Lyn: Opinionated?
Seyoko: Yeah. Basically, you’ve developed some kind of notion that I’m unfair or something!
Lyn: Well, You just seem to have a weird sense of duty, that’s all . . .
(Okazaki grunts, falling back into her seat with folded arms . . .
Seyoko: Hmmph!
(then, however, she eyes Anouilh once more—a shrewd smile gracing her lips . . .)
Seyoko: Oh yeah? Speaking of duty, I got an interesting call from Nerv’s Personnel Securities division.
Lyn: . . .
Seyoko: It seems you didn’t report in during the alert yesterday . . .
Lyn: . .so what . .
Seyoko: So what!?
Lyn: they don’t need me . . .
Seyoko: How the hell would you know that!? You’ve got a responsibility, Anouilh.
Lyn: There is nothing for me to pilot anymore—
Seyoko: So What? You’re on active duty now! Do you want to get in trouble?
Lyn: . . .
Seyoko: where were you, anyway?
Lyn: . . .
Seyoko: Lyn? where were you?
Lyn: I was . . I was just . . .
(Embarrassed to the point of shame, the boy
trails off; fingering the sleeves of his own shirt . . .
Finally, Seyoko stops her prodding, shaking her head--)
Seyoko: (annoyed) Well, it’s all in the past, now . . .like so many things . . .
(suddenly, the boy involuntarily shudders—looking at the girl across the table . . .)
Seyoko: . . .?
Lyn: . . .
Seyoko: What? What is it?
(Anouilh merely shakes his head, managing a reply--)
Lyn: Nothing. . . It’s nothing.
Seyoko: . .right . . .
-----------------------------------------------------------------------
(Meanwhile, in the Horaki residence on the
western edge of the Tokai district. . .)
(Sound of doorbell)
Hikari: I’ll get it . . .
(Hikari, still in the process of getting ready for school, hurries from her dresser mirror to the front door , as the frantic ringing of the doorbell sounds through the household . The girl’s hair is down, not yet tied in the petite pigtails that have become her hallmark . . .)
Hikari: I’m coming---!!
(Now somewhat annoyed, she finally reaches for the door—mumbling irately to herself . .)
Hikari: Who would be at the door so early in the morning . . .!
(As she pulls open the door, however, her question is answered—
. . . much to her dismay . . )
Hikari: (stunned)A—Asuka!!?
Asuka: . . .
(There, standing at the threshold, is Asuka Soryu . . . the girl is soaking wet, drenched from head to toe, shivering in the morning breeze . . .)
Hikari: Oh my God, what happened !? W--were you out in the rain all night!?
( Rubbing her dripping, pale arms, the girl
manages to nod—gasping as Horaki pulls her inside . . .)
Hikari: It’s okay—
(without hesitation, the class representative takes her shivering girl into her room—pulling the sheets of her yet unmade bed around the EVA pilot’s shoulders . . .
Image by Elaine Cardenas
As Hikari holds her close, she cannot help but shudder
at the sight of her friend in such a state . . .)
Hikari: Oh, Asuka, why did you do this . .!?
(The young German’s response, however, makes little sense . . .)
Asuka: . . I n-needed . . . to w-walk . . .
Hikari: what?
(The quaking girl shakes her head, looking Horaki in the eye . . .)
Asuka: I . . . I needed to walk . . . I’m s-sorry . . .
(Hikari looks back at her—brushing aside wiry strands of damp hair from her face . . .)
Hikari: (confused) It’s . . . It’s okay . . .
-----------------------------------------------------------------------
(Sound of humming)
Tenkei: . . ?
(Sound of humming)
Tenkei: Shou fe?
(Elsewhere, in Katsuragi’s residence on the
other side of town . . .
The Ev.N complement, "Tenkei", has awoken to a most peculiar sound—)
Tenkei: . . ?
(The child slowly comes to a sitting position on the bed, rubbing his eyes as the noise continues . . .)
Tenkei . . .
(Sound of humming)
(Hesitating for a moment, the boy finally climbs off the bed, walking tentatively toward the source: the open bedroom door.)
(Sound of humming)
Tenkei: . . . ?
(As he approaches, he can hear running water. . . this is soon silenced, though, by the sound of a tap shutting . . .)
(Sound of humming)
Tenkei: . . . ?
(At last, Tenkei wraps his fingers around the door frame—peering into the hallway . . .)
Tenkei: . . . ?
(Down the hall, open bathroom door is visible. Inside, he can see Misato, a large towel wrapped around her torso under her arms, drying her hair --)
Tenkei: (whispering) Shou B’nit halua . . .?
(His eyes now filled with a sense of recognition,
the boy relaxes—stepping out into the hallway as Katsuragi finishes and
exits the bathroom . . .
Unfortunately, she does not notice the small person in the corridor--)
Misato: Nnnnh . . . feels a little better, but—
(Suddenly, Misato becomes aware of the child standing in front of her--)
Misato: Huh?
Tenkei: Sabbah’al nur . . .
Misato: Jeez!
(Startled by the small boy’s greeting, the woman stumbles back—catching the edge of her towel with her heel—
--which, in turn, causes the makeshift cover to slip away as she falls to the ground . . .)
Tenkei: !
Misato: oof!!
(cursing under her breath, the woman props herself up on her elbow, rubbing her head . . .
. . . it is not until several seconds have passed, though, that she realizes the little boy is staring at her; a wide-eyed, bewildered expression gracing his young face . . .)
Misato:---wh--
( . . . an instant later, she realizes this is justified, considering her position . . .)
Misato: Uh-—!
Tenkei:--!
(At first, she can only look back, equally as stunned . . .
(Then, however, Tenkei begins to giggle childishly-- pointing a small finger at the unclothed Misato Katsuragi sprawled out on the floor before him--)
Tenkei: (chuckling) Ooman!!
(Without further hesitation, Katsuragi pulls the edges of the towel around her, at last covering up. She stands, cursing to herself as she steps past the child, into her room, shutting the door behind her . . .
It is not until she has regained her dignity, however, that she comes to a startling realization—)
Misato: (thinking) wait--Why would I be so embarrassed at
him seeing me? He’s just a little kid, right?
(Curiously enough, as she begins to brush
the knots out of her hair, she finds the odd feeling won’t go away . .
. )
Misato: He’s a cute one, though . . .
(Even more strange, there seems to be a sense of . . . familiarity . . . as well . . )
Misato: (mumbling) Jeez, Ritsuko . . . you'd probably Kill me for that . . . .
-----------------------------------------------------------------------
(Almost an hour later—As Katsuragi pulls the edges of her jacket about her shoulders, there is the sudden sound of the front door sliding open. Immediately, she runs out into the corridor, calling--)
Misato: Shinji!? Asuka!?
Shinji: (quietly) It’s me, Misato.
(The woman sighs with relief, stepping toward
the boy . . .)
Misato: Shinji, where were you!?
Shinji: . . .
Misato: Well?
Shinji: (in passing) sorry if I worried you . . .
Misato: . . . look, I know how your feeling right now . . .
Shinji: . . . no, you don’t.
Misato: . . .
(The woman comes to a stop, detecting a new emptiness in the boy’s voice . . .
So great is it, she does not push the matter further . . .)
Misato: . . . There’s someone here I have to tell you about before I go . . .
Shinji: some--one?
Misato: . . . listen . . .
-----------------------------------------------------------------------
(Meanwhile, in a remote, secluded installation several thousand miles away . . .)
Announcer: (In English) Attention, all general staff and cage
crew. Insertion sequence commencing.
All non-essential personnel are to vacate the test area immediately.
. .
Technician A: Evangelion Unit 04, autopilot entry module inserted. Systems are go.
Technician B: Beginning countdown. 6th Test sequence will begin in T-minus 20 seconds—
Technician !: Mark—
(In a massive, brightly lit chamber that is stark contrast to the dim dreariness of the Nerv Test Cages, a gray, armored behemoth stands attached to a restraining scaffold nearly 30 meters high. Around it, nerve control centers and test monitoring stations dot the immense framework, each overseeing and regulating a multitude of different points of the start up procedure . . .)
(In the main control booth, situated across from the creature, a parade of technicians, controllers, army and service personnel watch in anticipation as the sounds of the energy generators begin to fill the hangar--)
Technician A: Power supply is verified.
Technician C: Autopilot-nerve connection is at 30% and rising. Absolute borderline in 15 . . . 14 . . .
(As the ambient hum of the power connections begins to rise in pitch, one person in particular—a dark suited, nervous looking woman, remarks to the older man at her right--)
Director: They are positive the Evangelion suffered no damage?
Service officer: Yes ma’am.
Director: What about the components?
Service officer: As the report stated, all were moved to a safe location the previous night . . .
Director: Hmm . . .
Service officer: It seems that, for once, we can thank congress for their budget restrictions . . .
Director: It seems. . .
(Suddenly, the eyes of the beast begin to burn red with intense power—the Eva straightening up along the scaffold, as energy once again begins to circulate through its body . . .)
Technician A: what is the status of the solenoid power plant?
Technician B: Nominal. . .
Director: . . However, I would not be so quick to thank Washington.
Service Officer: If they hadn’t made such a stink about moving to a less costly test site—
Director: Yes, yes; well, It is in their best interests . . .
Technician B: Absolute-L rising . . . approaching absolute borderline--
Technician A: 10 seconds . . .
Service Officer: Still, if the test succeeds, will you continue with congress’s plan?
Director: A plan based on Seele’s claims . . . and UNS’s allegations? Perhaps . . .
Service Officer: What about--Off the record?
Director: Off the record . . .
Technician A: 5 . . . 4 . . . 3 . . . 2 . . .1 . . .
Technician B: Absolute borderline—!
Technician A: . . .
Director: . . .
Security officer: . . .
(indeed, at that very moment-- as the indicator
on the instrument panel approaches 0, the entire staff within the control
center becomes deathly silent . . . and, for a fraction of a second, the
terminal reads just above Absolute-L . . .
then--)
Technician A: Borderline cleared—ready to enter induction mode. . .
Technician B: System verification complete . . . M.A.R.I., Evangelion unit 04, reactivated . . .
Security officer: Well?
Director: Off the record—I think the world would be better off
if Nerv, Seele, and UNS were all wiped off
the map . . .
Security officer: . . .
(At this, the old man falls silent—Finding no more to say as the induction sequence begins. . . )
-----------------------------------------------------------------------
(Elsewhere, a few hours
later, the noon sun seems to hang lazily over the city of Tokyo 3.
Its golden rays bathing the metropolis in heat, the solar orb is visible
through large vents in the city floor—allowing the light to stream into
the interior of
the lush, green geofront . . .
Almost 1,000 meters below, the titanic steel doors that mark the entrance to central dogma slide open, allowing Major Misato Katsuragi to enter . . .
Soon, she is on one of the dozens of moving catwalks, descending the main shaft toward the command level, where the control center is located . . .
as she reaches the midway point—a security station complete with Nerv Card interface and a security linkup—Katsuragi stops, pulling out her cellular telephone . . .
a sequence of numbers ensues, and soon, Makoto Hyuga’s voice is heard on the telephone's speaker . . .)
Misato: Hyuga? This is Katsuragi.
Hyuga: Yes, Major?
(Oddly enough, the young technician's tone seems to indicate a sense of confusion . . .)
Misato: I’ve come in a little early today. Anything to report?
Hyuga: No ma’am—Besides a slight mix-up in the 3rd shift rotation,
It’s all been the same since you last
checked in.
(Misato brushes a stray lock of hair from her face, puzzled.)
Misato: Since I last checked in?
Hyuga: Yes. . .
Misato: When was that?
Hyuga: About 3 hours ago, I think . . . why . . .?
Misato: Hyuga, I just got here.
Hyuga: . . .
Misato: Bring up the security log—I’ll be right there—
Hyuga: Yes ma’am . . .
(Quickly, the woman hangs up the telephone—running down the moving escalator toward her final destination . . .)
-----------------------------------------------------------------------
(Mere moments later, in the bustling control center . . . Misato Katsuragi enters, hurriedly removing her somewhat bulky flight jacket—tossing it onto a chair, she finds her way to Hyuga, who is seated at one of the main terminals on the control deck . . .)
Misato: I’m here—where’s the file?
(gazing at her from over his shoulder, The man nods, leaning to the side--)
Hyuga: (indicating the terminal) Here. It says you came in at around 0900 hours JST this morning . . .
Misato: Is there a visual record?
Hyuga: No—whoever it was, they came in at station CD-gate 13.
That’s a security code login, and
nothing more, since its one of the few non-essential areas outside the
security perimeter . . .
Misato: What’s it say?
Hyuga: 0900 hrs, Major Misato Katsuragi, 0001010110111.. .
(Suddenly, the man pauses, leaning closer to the display--)
Hyuga: Wait a minute . . .
Misato: What? What is it?
(The woman leans closer . . .much to Makoto’s slight chagrin . . .)
Hyuga: (coughing) Um—it says here you brought a visitor in . . .
Misato: A .—visitor?
(Glancing back at her for a moment, the man
nods—pushing his glasses up his nose.
Katsuragi stands, looking a bit confused . . .)
Misato: Who would . . .
(Suddenly, the woman’s eyes go wide with stark realization—
Then however, they narrow in a darkened, vehement rage . . .)
Misato: (growling) That little---RRrrrgh!
(Furious, Misato turns— grabbing her coat and making her way toward the door . . .
Hyuga, meanwhile, turns toward the woman, calling--)
Hyuga: Major Katsuragi! Wait—
Misato: Hmm?
Hyuga: Do-- You want me to report this to S2?
(Katsuragi comes to a stop—looking back toward the control operator . . .)
Misato: (quietly) . . No. Better leave the security division out of it.
Hyuga: . . .
(spitefully, the woman turns again, heading toward the door--)
Misato: I’ll handle this myself . . .
(A moment later, the woman exits—
Hyuga, meanwhile, turns back to his terminal, typing in a final set of commands . . )
SECURITY FILE #006156
DELETE . . .
COMMAND COMPLETED—FILE PURGED
(Deftly, he glances back at the door from which Misato exited—a look of anxiety on his face . . .)
Hyuga: . . . watch yourself . . .
-----------------------------------------------------------------------
Hikari: You . . . are you feeling better, now?
Asuka: . . .
(Meanwhile . . . in the Horaki residence located outside the city above . .)
Hikari: Well?
Asuka: I’m sorry, Hikari. Coming to you like this . . .
Hikari: It’s okay—really.
Asuka: I just don’t know what to do anymore . . .
Hikari: . . .
Asuka: Sometimes . . . sometimes I think I just want to kill myself, you know?
Hikari: Don’t say things like that, Asuka! You’re scaring me!
Asuka: Well, it’s the truth.
Hikari: . . .
Asuka: What time is it . . .?
Hikari: It’s about noon. The school’s probably on lunch break, right about now . . .
Asuka: . . . I wonder if he’s there . . .
Image by Elaine Cardenas
Hikari: Hmm?
Asuka: third child . . .
Hikari: Why would you want to know about him . . .?
-----------------------------------------------------------------------
Shinji: . . hello?
(Elsewhere . . . Misato’s apartment has become
eerily quiet, following her recent departure . .
Within, Shinji Ikari wanders from room to room—seemingly, searching
for something . . .
or someone . . . )
Shinji: . . .
(soon, the third-child’s roaming finds him at the open doorway to his own bedroom—
where, it seems, he finds what he has been looking for . . .)
Shinji: . . .
(Before him—in the dimly lit quarters he has come to know so well—a strange child with bleached-white hair sits on his bed, facing the wall . . . oddly enough, the boy appears to be enthralled with something in his hands, completely oblivious to Shinji’s presence . . . )
Shinji: Hey . . .
Tenkei: . . .
(The child does not so much as flinch as Ikari calls. Curious, Shinji steps into the room—approaching the bed with almost apprehensive interest . . .)
Shinji: . . .
(As he nears the boy, though, he finally catches a glimpse of the object of the child’s curiosity . . .
In his hands, Tenkei is puzzling over Shinji Ikari’s personal stereo . . .)
Shinji: um . . .
(At last, the younger boy lowers his gaze. Turning around, he faces the third child—holding the Walkman up to Ikari’s face, looking to him with pleading eyes . . .)
Shinji: . . oh . .
(Puzzled, Shinji takes the stereo in hand—
Then, it is only after a few seconds that he realizes the child’s desire. . .)
Tenkei: . . .
Shinji: Oh . . . here . .
(leaning over, he places the headphones in the small boy’s ears—as he does this, the child looks on inquisitively . . .
. . . seemingly, he is searching Ikari’s face with his eyes . . .)
Tenkei: . . .
(Stepping back, Shinji lifts the tape player, depressing the "play" button. Almost at once, soft, tinny music can be heard coming from the small speakers. . .)
Tenkei: . . .!
(As the melody begins to fill his ears, the little boy’s face brightens—
Ikari, oddly enough, finds himself smiling, as well . . .)
Shinji: . . .
(Within a moment or two, the song ends . . . slipping down from the bed, the child removes the headphones, placing them into Shinji’s palm . . .)
Tenkei: Thank . . you . . .
Shinji: You like music, huh?
Tenkei: . .yes . .
Shinji: . . .
Tenkei: Shou Taibe . . .A song . .is good.
Shinji: . . .?
Tenkei: A song . . . brings us joy.
(Still smiling, the boy walks past Shinji— With soft footpads, he turns down the corridor into the living room, disappearing from sight . . .)
Shinji: . . .
Image by Elaine Cardenas
(Ikari, meanwhile, is motionless-- stunned
by the child’s words . . .)
Shinji: . .
-(flashback)- Kowaru: A song is good! A song brings us Joy . . .
Image by Elaine Cardenas
-----------------------------------------------------------------------
(Elsewhere . . . nearly 2,800 meters below the surface . . .
In the very deepest tunnels of the underground Nerv base . . .
Seyoko Okazaki stands at the security console mere feet from the entrance to the main LCL production plant, in the place known as Terminal Dogma . . .)
Seyoko: (whispering). . 1 . . .0101 . .01100101 . . .
(As the woman keys in the nearly endless sequence of numbers, tinny electronic beeps can be heard echoing through the tunnel as she utters each digit of the binary password . . .)
Seyoko: (whispering) . .0110110110 . .
(As she finishes the sequence, a harsh tone comes
from the console, which displays the words
INVALID COMMAND
. . .)
Seyoko: (whispering). . .Damn, not it . . .
(Hunching over the terminal, she begins again—typing in the sequence with extra care . . .)
Seyoko: (thinking) 1010101100 . .10 . damn!
(annoyed, she hits the "CLEAR" button, starting over yet again . . .)
Seyoko: (whispering) 1010101100100110110110 . . . Ah!
(At last, there is a high pitched beep as the computer finally confirms the code, displaying the words:
COMMAND CONFIRMED. INSERT SECURITY ID—
(With a relieved sigh, the girl places the card in the reader,
But stops—
As the cold, steel barrel of a 9mm Beretta is placed squarely against the back of her head,
Followed immediately by the "click" of the safety being unlatched)
Seyoko:---
Misato: Well, well.
Image by Elaine Cardenas and Maher Al-Samkari
(Slowly, Okazaki straightens—her hand still on the card in the reader. . .)
Seyoko: . . .
Misato: Correct me if I’m wrong, but think your going a bit above and beyond the call of duty. . .
(Surprisingly, the Lieutenant smirks--)
Seyoko: What can I say . . . I am a career girl . . .nngh--!
(She is cut off with a whimper, however, as Katsuragi presses the barrel of the gun into her skull--)
Misato: You’re in no position to joke.
Seyoko: What makes you say that?
Misato: Look at the sign on the wall to your right.
Seyoko: . . .?
(slowly, the woman shifts her gaze—her eyes darting to the stenciled letters above the console:
TRESPASSERS MAY BE SHOT ON SIGHT
)
Misato: As you can see, I’m well within my legal bounds to blow your goddamn head off.
Seyoko: . . . And what’s stopping you?
Misato: Call it pity. I’m curious as to know why such a young kid is so eager to die.
Seyoko: Nice try.
Misato: Who the hell are you. . ?
Seyoko: Lieutenant Seyoko Okazak—uuhngh!!
(The younger woman grunts once more as the Barrel of the gun is jammed ever deeper into the skin above her neck . . .)
Misato: Who are you really . . ?
Seyoko: Uunnh! I told you who I am!!
Misato: So, I can assume then that it was UNSynaps that put you up to this . . ?
Seyoko: . . .
Misato: Well?
Seyoko: You can't presume anything, lady. . .oof!!
(The woman lets out a small yelp as Katsuragi grabs her by her collar, slamming her back into the wall of the tunnel—
As she opens her mouth to protest, however, she quickly stops as the barrel of the gun is placed under her chin . . .
Misato puts her face within inches of hers, glaring at her --)
Misato: Let’s play a game. I’m going to ask you a question.
For every stupid answer you give, I’m going
to pull the trigger.
(Snarling, Katsuragi tightens her grip about the girl’s collar--)
Misato: Sound like fun?!
(Seyoko, however, smiles wryly—then frowns, grumbling through grit teeth--)
Seyoko: Give it your best shot—Major. You’re not getting squat out of me.
(To the girl’s surprise, however, Misato’s look softens slightly—pulling the gun away, she takes a step back . .
Then, without warning, delivers a swift knee to Okazaki’s abdomen—knocking the girl to the ground . . .)
Seyoko: (panting) . .!!!!
Misato: Now, answer my question—
(Misato is cut off in mid sentence, however, as Seyoko brings her foot about--kicking Misato’s legs out from beneath her, sending her to the ground as well . . .
. . . it would seem that, in the lieutenant’s mind, the time for passive resistance has ended . . .)
Seyoko: (panting) You’re not . . . very good at . .interrogations!!!
Misato: Try me!
(Now considerably angry, Katsuragi comes to her feet— forcing Seyoko into the bulkhead . . .)
Misato: ugh—!!!
(Misato grunts in pain as the girl manages to get a leg in—knocking her to the floor with a kick . . .)
(As she struggles to stand, Seyoko scrambles to the console—grabbing the card still sitting in the security reader on the terminal—
As soon as she has it , however, she feels a pair of hands seize onto her jacket—pinning her face-first into the ground, and causing the precious card to slip from her fingers . . )
Seyoko: What---!!??
(Her startled yell is immediately silenced by the familiar feeling of cold steel pressing against the back of her head. . .
It would seem Misato has resorted to using the gun once more . . .)
Seyoko: (Panting) Shit . . .
(Now furious, Misato kneels over her—digging her knee into the small of the woman’s back . . .)
Misato: (panting) Now, Who the hell are you working for . . .?
Seyoko: . . .
(The girl remains resolute, however, closing her eyes as she stubbornly awaits the inevitable . . .)
Misato: (shouting) Answer! . . .
Seyoko: . . .
(Suddenly, something on the ground next to the girl catches Katsuragi’s eye . . .)
Misato: . . . ?
(leaning over slightly, Misato picks up the security card next to Seyoko’s hand . . .
as she brings it near her face for closer
examination, however, Her eyes widen in
abject horror as she reads the name bared on it . . .)
Misato: (whispering) Oh My . . . God . . .
Seyoko: Ow—hey--!
(Seyoko protests once more as she is suddenly dragged to her feet, her back forced against the wall yet again . . .)
(As she opens her eyes, she finds Misato staring directly at her, wearing a combined look of anger and despair . . .)
Seyoko: What? What is it--?
(As if to answer her question, Katsuragi holds the red Nerv card up to the girl’s face --)
Misato: Where . . . did you get this?
Seyoko: What are you talking about?
(Her patience now spent, Misato thrusts the security pass closer—)
Misato: (shouting) Where did you get it!!?
(It is then that Lt. Okazaki notices, to her surprise—
there are the barest traces of tears gathering at the edges of the woman’s eyes . . .)
Seyoko: . . .
(Seyoko finds herself speechless once more, as Katsuragi points out the name emblazoned on the pass . . . )
(Finally, looks back at the woman, answering her question . . .)
Seyoko: . . . It was given to me.
Misato: Given? By who!?
(Okazaki’s gaze narrows, as she stares directly into Misato’s eyes, replying slowly . . .)
Seyoko: (loudly) It was given to me by its owner . . .
Misato: . . .!
Seyoko: (firmly) . . . Ryouji Kaji.
-----------------------------------------------------------------------
Operator: Clearance accepted. Please state your 4 digit international code . . now.
Lyn: (slowly) 1-5-6-6.
Operator: Connection to Oxford, England has been completed. You may dial your local number.
Lyn: . . .
(Meanwhile, in the apartment of the 7th child, Lyn Anouilh holds the receiver of his telephone in hand as he dials the all too familiar number for his former home . . .
within seconds, the sound of the ringing on the other end can be heard . . .)
Lyn: (in English) . . . Ah! Hello? Is Mr. Anouilh in?
(The boy’s voice is almost a stutter— belying a high degree of nervousness . . .)
Lyn: This is his son. Lyn.
(A moment later, the boy frowns as the person on the other end replies in the negative . . .)
Lyn: Oh, is he . . .? No, that won’t be necessary
. . .I’ll try again later. What? No, I don’t want to
talk to her. Thank
you.
(Now wearing a blank expression, the boy looks at the phone.)
Lyn: (quietly) You’re never in, are you?
-----------------------------------------------------------------------
-(Flashback)-
2008 AD.
Oxford
Anouilh: Stand up straight. You don’t want him to think you’re lazy, do you?
Lyn: . . .
Anouilh: What’s the matter now?
Lyn: I don’t understand. Why are you sending me away ?
Anouilh: I told you, I’m not just sending you away. He’s going to be your tutor for a while.
Lyn: But why do I have to go? I don’t like him . . .
Anouilh: I’m very busy, Lyn. I don’t have time to take care of you.
Lyn: . . . why . . Why can’t you leave me with Seyoko . . .?
Anouilh: Don’t be foolish. That girl is much to young to take care of you for this long.
Lyn: . . .
Anouilh: I’m doing this with your best interest in mind. You know that.
Lyn: . . . I wish mother was here . .
Anouilh: . . .
Lyn: . . .
Anouilh: Well, she isn’t.
Lyn: . . .
Anouilh: Ah, here he is.
Arnold: Hello again. Ah, I see you’ve brought Lyn with you.
Anouilh: It’s good to see you again.
Arnold: Yes, indeed it is. I have some papers for you to sign, if it’s not too much trouble.
Anouilh: He’ll be in your care until the 19th, correct?
Arnold: Yes. It’s not too often that I’ll train a child personally, but Lyn has showed quite some talent.
Lyn: . . .
Anouilh: Did you hear that?
Lyn: . . .
Arnold: I’ve never seen any of the other boys his age handle a rifle so well, actually.
Lyn: . . . but . . .why do I have to leave?
Anouilh: You’ll have to stay on the base campus for a while. It’s part of your education.
Lyn: . . .
Arnold: Remember, Lyn. Don’t be a coward. You want to make your father proud, don’t you?
Lyn: . . . Are you doing this because your mad at me?
Anouilh: . . .
Arnold: Now, lad--
Lyn: for what I did? To Mother?
Anouilh: this is not the time.
Lyn:. (thinking). . . Because you really hate me, papa?
-----------------------------------------------------------------------
(the Present,
2015 AD )
Lyn: (thinking) Because you blame me . . .?
(Roughly, Lyn hangs up the phone, looking out the window. )
Lyn: Because that’s what I’m doing now?
(Then, oddly enough, the telephone begins to ring—jarring him back to reality . . )
Lyn: (surprised) bloody---oh . . .
(cursing under his breath, he picks up the phone . . .)
Lyn: Hello?
Aoi: (over the phone) Lyn?
(Upon hearing the girl’s soft voice, Anouilh’s face brightens--)
Lyn: Aoi! Oh, I’m so glad you called!
-----------------------------------------------------------------------
(Simultaneously, at a pay-phone inside the school . . .)
Aoi: . . ?
Lyn: (over the phone) Are you still mad at me? I’m really sorry about what I s—
Aoi: (interrupting) I’m not . . mad at you.
Lyn: . . . Where did you go? You weren’t answering your telephone . . . I got worried .
Aoi: My phone was down . . from the storm last night.
Lyn: Oh. Well, I really want to see you . . .
(Aoi’s eyes widen with a start--)
Aoi: You do?
Lyn: Yeah. Can you come over here?
Aoi: . . .
Lyn: Aoi?
Aoi: Y—yes, I will. Not until later tonight, though. Okay?
Lyn: . . Okay. . . but, why?
Aoi: . . . I have some things I have to do first.
Lyn: Can you talk right now?
Aoi: N—not right now.
Lyn: I guess . . I’ll see you tonight, then?
Aoi: Yes.
Lyn: Goodbye.
Aoi: ‘Bye.
(Slowly, the girl hangs up the phone. Stepping away, she hugs her arms close to herself, shaking her head . . .)
Aoi: . . . I have to deal with the 2nd child first . . .
-----------------------------------------------------------------------
(Later that evening . . . in the restaurant hanging high above the Geo-front . . .)
Misato: Here.
(Reluctantly, Seyoko takes the kerchief—tending
the small cut on her cheek . . )
Seyoko: thanks. . .
Misato: Well ?
Seyoko: (sighing) I work for Japan's Ministry of the Interior. That’s where I met him.
Misato: . . . and?
Seyoko: And what? I answered your question.
Misato: Not exactly.
Seyoko: . . .
Misato: (indicating her glass) Do you want something to drink? the sake here isn’t too bad . . .
Seyoko: No thanks. I don’t drink . . .
Misato: (taking a drink) Really? Hmm, you know, you don’t look underage. . .
(Okazaki glares at her, disregarding the joke . . .)
Seyoko: . . . I don’t see the point in this, Major.
Misato: You can call me Misato . . .
Seyoko: You trying to get me drunk, Ma—
(she stops, correcting herself)
Seyoko: -- Misato? So I’ll spill? Hmmph. Nice try.
Misato: . . . I’m not holding you at gunpoint . . for the
moment. I just want to know how you came to
know Kaji . . . trust me.
(Seyoko’s look softens a bit, and she sighs, going on . . .)
Seyoko: . . . he and I were both in the special services
division. I met him about 3 years ago—
After I got into SSD. . . he taught me the basics of the business.
Misato: the "business?" You mean espionage?
Seyoko: . . .
(Seyoko stops, sending Misato an Icy glare . . . )
Misato: Well . . ?
(Taking a drink, the younger woman disregards her, continuing . . .)
Seyoko: . . . anyway, after he was assigned to . . . investigate
. . . Nerv’s Japanese branch, I was sent
back to Britain to look in on Synaps. Around that time, it was a
corporation that dealt with the
UN in arms and satellite communications. They had a few dealings
in northern Japan--some defense
contracts-- but nothing major . . .
Misato: S-sounds pretty dull . . .
Seyoko: (thinking) Jeez, is she tipsy already?
(Eyeing Katsuragi curiously, Seyoko responds . . .)
Seyoko: It was. At least, until they became an independent
establishment in the U.N. Then, suddenly, I
was important.
Misato: And . . how did you get the card?
Seyoko: I kept in contact with Ryouji as best I could . . . until recently—
Misato: . . .
Seyoko: Then they told me. . they suspected he was dead.
Misato: . . .
Seyoko: When I returned to Japan, I found the card waiting for
me. He told me he would be trying to
Get in touch with an old friend. Someone he trusted . . . you, I
suppose.
(Suddenly, she smirks--)
Seyoko: Hunh. He never shut up about you. Even when he was hitting on the other girls . . .
Misato: . . . If you don’t mind, I’d like us to stick to the subject--
Seyoko: So . . . I finished my tenure at UNS, and came here to
find his contact. I took the position as
Lyn’s liaison, because it was the easiest way in. . . and because I wanted
to keep an eye on him. Satisfied?
Misato: You really care about that kid, don't you?
Seyoko: That’s my business . . .
Misato: He's the reason you left, isn't he?
Seyoko: (quickly) No--I--
Misato: . . .
(The younger woman becomes hesitant, folding her
arms . . .a moment of silence passes
between the two until, at last, she speaks . . .)
Seyoko: (quietly) I . . .screwed up big time . . .that’s
why. After Lyn’s EVA went . . Berserk . . .There was a
danger that what I was doing might expose me . . . so I went back to poking
around Britain for a couple
months . . . Besides, I had a ton of Kaji’s findings to sort through .
. .
Misato: Takin’ the initiative, eh? Not too bright. . .
Seyoko: . . .
Misato: So? What did you find?
Seyoko: That’s it. Look, I’ve told you what you asked for, what are you going to do with me?
Misato: What, you still don’t get it?
Seyoko: Get what?
(Misato shakes her head, repeating herself . . .)
Misato: (mumbling) You still don’t get it. I can’t imagine a spy being so completely thick.
Seyoko: What the hell’s that supposed to mean?
(Looking at the woman with clouded eyes, Misato gives her a shrill smile, pulling something from her pocket and tossing it onto the table in front of her. . .
. . .before going back to her drink . . .)
(Seyoko eyes it for a moment—and quickly recognizes the object . . .)
Seyoko: (shocked) The-----the chip?! You !?
(Misato continues grinning, an almost drunken look of satisfaction crossing her face . . .)
Misato: I’m in’ this deeper than you, girlie.
Seyoko: It makes sense . . .
Misato: now, as you were saying . . . what were you doing in Nerv’s basement?
Seyoko: (hesitantly) V . .Verifying the existence of Lilith.
That’s as far as I got with everything that’s
been happening.
Misato: And what about UNSynaps?
(As Katsuragi says this , Seyoko nearly chokes on her drink --)
Seyoko: (Coughing) th--That’s a different story altogether . . .
Misato: I’m listening . . .
(rubbing her throat, the woman swallows—Looking at Misato curiously . . .)
Seyoko: The best I can put it is this--They are Nerv’s replacement.
Misato: . . .what?
Seyoko: Seele needed a new pawn . . . someone who could carry
out their little plan for Adam and the
Human instrumentality project. Nerv didn’t prove to be too helpful.
UNS was happy to accept.
Misato: . . . why?
Seyoko: Are you familiar with Khabbalism, Major?
Misato: That’s ‘Misato.’
Seyoko: Whatever. UNS is. Special intelligence
had me look into their
dealings with Seele about 6 months ago . . . when they were privy to allegations
that Nerv was
trying to incite the 3rd impact.
(The woman leans closer to Katsuragi, her eyes going narrow . . . though somewhat clouded, now . . .)
Seyoko: You were all this close to being fragged. The army
was recommending a level one cleansing
operation—a complete purge of all personnel, military and civilian.
They even approved the use
of N2 mines.
Misato: . . .No prisoners. . .
Seyoko: Yeah.
Misato: What happened . . . what stopped them?
(Seyoko pauses to take another, larger drink, which seems to loosen her tongue even more . . .)
Seyoko: As far as I can guess, the city got in the way. You’re
lucky someone made it a big deal
to get international attention on this place, or we would be sitting in
a crater. The JSSDF didn’t want another
incident, and I guess they decided to hold off until there was absolute
proof of your commander Ikari’s intentions.
Misato: And?
Seyoko: They’re still waiting.
(Seyoko leans back, looking at her drink as it hangs lazily from her finger tips . . .)
Seyoko: . . what the Heck kindof name is "Ikari," anyway . . .
Misato: Well?
Seyoko: Oh, yeah--So--- you’ll understand why I’m in such a hurry.
The committee has been trying to
compromise this place covertly for the past 5 months . . .
Misato: Then . . . the committee’s behind the Angel attacks?
Seyoko: From what I’ve learned . . .
Misato: But they don’t have the resources to create those things—not
if they want to keep out of the
public eye . . . and the other Nerv branches couldn’t have done it,—
Seyoko: You’re right.
Misato: I am? But, then, who did—
(Misato freezes, however, as Seyoko places a finger on the UNS badge below her collar. . .)
Seyoko: Take a guess . . .
-----------------------------------------------------------------------
Hikari: If you like him, why don’t you tell him?
Asuka: . . .
Hikari: Asuka, what’s happened to you?
Asuka: You don’t get it, Hikari.
I have to be strong. I have to win.
If I lose, I’m less than anyone else—
Hikari: Now wait a minute—
Asuka: NO, Hikari! It’s the TRUTH!
(Asuka looks at her hands, which cling at the edges of her skirt--)
Asuka: I can’t stand for him to look at me now . . . If he knew how weak I felt . . .
Hikari: You’re not weak!
Asuka: Look at me, Dammit!
Hikari: . . .
Asuka: I placed such a high price on being a pilot . . . and now, I don’t even have that. . .
Hikari: . . .
Asuka: It’s only a matter of time before they put me in an entry plug . . .
Hikari: . . .
Asuka: Again . . .
(With these last words, Soryu’s voice cracks—
Hikari, in turn, leans closer to her friend. . .)
Asuka: (quietly) Why does this have to happen to me?
Why always to me . . . ?
Hikari: Shhhhh . . .
-----------------------------------------------------------------------
Shinji: Hey . . . Tenkei?
Tenkei: Shou fe, waladithani?
Shinji: . . .?
Tenkei: What-do-want, Shin-ji?
Shinji: Who—
Tenkei: . . ?
Shinji: Who are you?
(Meanwhile, in the living room of Misato Katsuragi’s apartment . . . Tenkei sits sprawled out on the floor, watching Television . . . behind him, Shinji Ikari stands, his face full of confusion . . .)
(As soon as Ikari asks the question, Tenkei looks up at him, smiling . . .)
Tenkei: Ten-kei.
(Shinji, however, frowns—falling to his knees, bringing the child’s face to eye level . . .)
Shinji: You’re him, aren’t you?
Tenkei: . . . ?
Shinji: Nagisa.
(The boy’s eyes widen for a moment, taken aback in sheer astonishment . . .
. . . before he shakes his head, placing a finger on Shinji’s forehead--)
Tenkei: Shinji guess wrong!
Shinji: -!-
(Ikari nearly trips and falls, stumbling backwards as the child laughs to himself . . .)
(It is when Shinji regains his composure, that the child’s look softens . . .)
Tenkei: You . . . are sad, because she is far away, yes?
Shinji: What?
Tenkei: A W-oman.
(Suddenly, there is a sound of slow footsteps at the door to the living room as someone else enters . . .)
Tenkei: . . .
Pen Pen: . . ?
(Tenkei looks on in sheer amazement at the short, warm water Penguin as it makes its way toward the TV. . . )
Pen Pen: . . .
(Upon seeing the small child, the penguin comes to a stop. . . Tenkei comes to his feet, standing toe to toe with the bird. For what seems like an eternity, the two simply stand there, regarding one other—
Until finally, Pen Pen steps past the child, who then returns to his seat . . .)
Pen Pen: Qwuaa!
Tenkei: . . .
(within seconds, they are both planted in front of the television, acting as if nothing had occurred. . .)
Shinji: . . . ?
-----------------------------------------------------------------------
Gendo: How are you feeling?
Rei: . . . I am very tired.
Gendo: Well, you must rest to regain your strength.
Rei: . . . I cannot.
Gendo: . . ?
Rei: There is not enough time.
(Meanwhile, in the Service hospital far below,
Rei Ayanami, still bedridden, finds herself the subject of a most
interesting visit . . .)
Gendo: What makes you say that?
Rei: I don’t know. I feel it is so.
Gendo: . . .
Rei: May I ask—
Gendo: hmm?
Rei: Why was I chosen?
Gendo: . . .
Rei: Chosen to be with Tenkei?
Gendo: . . .
Rei: . . . To be complemented?
Gendo: There is no one else who could have . . .
Rei: Why?
Gendo: . . . Because of who you are.
Rei: . . .
(Rei is silent for a moment, her eyes gazing up at the lighting fixture in the ceiling high above . . .)
Rei: Why not . . . Shinji?
Gendo: . . .
Rei: Do you favor me over him?
(Suddenly, Gendo stands—pushing his glasses up onto his face . . .)
Gendo: Get some rest. Very soon, it will be time.
Rei: yes, sir.
(As the man exits, Rei casts a emotionless
look at the table next to the bed—where, among her
other possessions, sits a broken pair of tinted glasses . . .
reaching over, the child takes them in hand . . . looking at them closely for the thousandth time . . .)
Rei: . . .Am I his replacement?
(. . . this is her last thought Before closing her eyes, relinquishing herself to sleep . . .)
Rei: (quietly) Shinji . . .
-----------------------------------------------------------------------
(That evening . . . As the very last stray
traces of sunlight dwindle and vanish behind sable hills in the distance
. . .
A lone, quiet figure can be seen wandering
the empty grounds of the city high school . . .)
Asuka: . . .
(Asuka Soryu makes no noise as she walks the
cool, hard pavement outside the collection of buildings
that makes up the school campus. Electric lights from the lamp-posts
dotting the area illuminate the grass,
shrubs, and sidewalks of the common area, where, during the day, the
children commonly sit and talk, or run
and play . .
Or, in the case of this EVA pilot, grieve . . .)
Asuka: (thinking) There is no reason for him to like me . . .
(As the girl walks on, she does not notice
a figure in the darkness, sitting on one of the many benches
that line the sidewalk . . .)
Asuka: (thinking) I’ve already ruined it anyway . . .
(suddenly, as Soryu walks by, oblivious to her surroundings, a voice is heard—
as the figure speaks . . .)
Aoi: Out for a late night walk, second child?
(Stunned by the sudden noise, Asuka stops in her tracks—
quickly, she turns on her heel, facing the source of the sound . . .)
Asuka: Who’s there?!
(In response to her question, there is a light
giggle—muffled as the person in the darkness tries to
hide her amusement with her hand.)
Aoi: Like you have to ask.
(At the sound of Tamashii’s stifled chuckle, Soryu relaxes, remarking with slight disgust--)
Asuka: . . .You . .
(Soon, her eyes adjust to the blackness between
the lampposts enough to make out Aoi’s figure,
stretched out casually on the park bench. )
Aoi: Oh, come on, what’re you so angry for? Did I scare you?
(shifting from her lazy position, the girl sits up straight, her own eyes glinting in the darkness . . .)
Asuka: You wish . . .
Aoi: I couldn’t think of anything that would scare the great Asuka Langley Soryu . . .
Asuka: Shut up. What the hell do you want, anyway . . .
(As Asuka begins to walk away, Aoi slowly shakes
her head . . . committing herself to
what she is about to do . . .)
Aoi: (mumbling) Asuka Soryu, you’re pathetic.
Asuka: . . .?!
(Upon hearing this, Asuka freezes in her tracks—stunned
by the sheer contempt in the girl’s voice . . .
her surprise is quickly replaced by rage, however, as she turns around
again . . .)
(This time, However, Aoi, too, is standing—facing her from almost 5 feet away . . .)
Asuka: What the fuck is your problem?
Aoi: You.
Asuka: Go to hell. Angamessen!
(With this, Asuka begins to walk away . . .)
Aoi: (flatly) Why are you running away again, little girl?
Where will you go, with no mother to run to?
(for a third time, Asuka stops: slowly, turning toward the other girl yet again. . .
but this time, nearly lunges—grabbing her tightly by the collar, glaring into her face . . .)
Asuka: (spitefully) Who in the hell do you think you are, Flitchen!?
Aoi: . . .
Asuka: You don’t know anything about me. don’t understand what it’s like at all—
Aoi: (quietly) Yes I do. I’ve known the pain you feel all too well.
Asuka: . . . Like hell!
Aoi: I know how much you hate yourself. How much you wish you were dead.
Asuka: . . .
Aoi: Am I right?
Asuka: No.
Aoi: Liar. I know you. On purpose, you turn everyone
away, trying to prove to yourself you don’t need
anyone. Even
the boy who liked you enough to try and be your friend, you pushed him
away.
You would have
to be blind and deaf not to see and hear it!
Asuka: No! That’s not true!!
(smirking, Aoi pulls the other girl’s hands away, taking a step back . . .)
Aoi: that’s what makes you pathetic.
Asuka: SHUT UP!!
Aoi: You’re A poor, frightened little girl who is too afraid to ACT like a little girl. . .
(She pauses, eyeing Soryu coldly . . .)
Aoi: . . . Just because mama hung herself from the rafters . . .
Asuka: (horrified) How . . . how do you know --
Aoi: You were grown up. You didn’t need to cry, or ask for
anyone’s help. But the truth is, you’re
just a weak
person.
Asuka: Gott im Himmel , What are you!!?
(heedless, Aoi continues . . .)
Aoi: You’re not even a real pilot anymore . . . That’s what made
you
worth something,
and now, you don’t even have that.
You’re just useless
. . .
(she is Cut off as Soryu grabs her roughly, an angry fire burning brightly in her gaze. . .)
Asuka: I’ll kill you . . .!
Aoi: (gravely) I would like to believe that, Lepchin. In due time, I hope it will be so.
Asuka: . . ?
Aoi: Go ahead and Take out your anger on me. You’ve
already exhausted your small supply of friends,
haven’t you? You’ve
even brought Shinji to hating you. I would say he is better off.
. .
(She stops as Asuka forces her to the ground, sheer rage visible deep within her eyes.
(unfazed, Aoi shrugs it off, stands, and turns away. . .)
Aoi: It must have been terrible . . . watching her go mad
like that. Treating you like a thing . . . like just
another face behind
the glass.
Asuka: . .
(Then, surprisingly, Tamashii steps toward the girl—putting her face within inches of Asuka’s . . .)
Aoi: You. You’re so afraid of being alone. You’re
so afraid that it terrifies you. Terrifies you enough
that you begin to deny it.
Does any of this sound familiar?
Asuka: Wh—what are you talking about?
Aoi: You never were able to be alone. Even When you were
so, you surrounded yourself with enemies.
Anything not to be
alone. Learn the truth now: We are all alone, Lilim.
You have only lived as
long as you have by
denying it. You’ve lived a lie, and not even a very good one.
As soon as you
start to lose again,
it all falls away like a house of cards.
Asuka: H—how do you know these things . . HOW DO YOU KNOW THESE THINGS ABOUT ME?!!
(Aoi ignores her, however--)
Aoi: But that’s not the worst part anymore, is it? Now, you find
yourself following her path.
Like mother , Like
daughter.
Asuka: . . no . . .
Aoi: . . . Right?
Asuka: . . .
Aoi: But If you do die . . . at least you will be with her again,
no?. . .
It is too bad
you are far too selfish to do it.
Asuka: Die . . .?
Aoi: (quietly) Don’t worry. Your toy . . . won’t work for you
the next time they put you inside it. You’re
too old to be playing with
dolls, anyway . . .
(Suddenly, Aoi's hand reaches out--touching the fabric over Asuka's heart, the fingers suddenly pass through the shirt, flesh, and bone as if there is nothing there . . . seconds later, she pulls the hand away, before the reality of her intrusion dawns upon the girl . . .)
Asuka: . . .
Aoi: . . . Maybe death will come for you then.
(It is with this that Aoi steps back—leaving Asuka to stand there, in a state of utter shock, as she slowly walks away . . .
At last, Soryu speaks . . .)
Asuka: (quietly) Who are you . . . ?
(Aoi, however, does not turn around when she answers . . .)
Aoi: I think . . . you already know. . .
(No more is said as she moves on, quickly vanishing from sight into the shadows of the overhanging trees . . .
. . . Leaving Asuka standing there, unmoving, to stare in astonishment at the darkness beyond . . . )
-----------------------------------------------------------------------
(meanwhile . . . in the corridors of Nerv far, far below . . .)
Seyoko: What will you do now, Misato?
Misato: I’m not sure. . .
Seyoko: Now that you know . . . are you going to tell your superiors?
Misato: There’d be no point in that. They wouldn’t believe me, and if they did, I’d end up like Ritsuko.
Seyoko: . . . there’s something else, you know . . .
Misato: hmm?
Seyoko: You could help me.
Misato: What?
Seyoko: there is a whole level of safeguards in the I/O system
I couldn’t get past . . . something to do with
Second Impact, human instrumentality, and something they called "Project
Ev.N."
(As she says this, Misato looks away for an instant, thoughts of the previous night suddenly fresh in her mind . . .)
Seyoko: There is a firewall protecting the data . . . I can’t get past it, even with the card.
Misato: So what do you want me to do?
Seyoko: You can get into the control center any time you want.
If you can access the one called
Melchior, that would be enough!
Misato: What? Why Melchior?
Seyoko: It seems that’s where all the data is stored.
Misato: . . .
Seyoko: Well?
Misato: If I said yes, how would I go about doing it?
-----------------------------------------------------------------------
Gendo: Absurd.
Fuyutsuki: "Absurd" as it may seem, those are the facts.
Gendo: But why now? Why would they suddenly request an audience?
Fuyutsuki: Who knows? They certainly can’t do anything to you from the remote chamber.
Gendo: . . .
Fuyutsuki: Possibly it will provide insight into what they are planning . . .
Gendo: Doubtful, professor.
Fuyutsuki: . . .
Gendo: Even so . . . it is an opportunity, in any case.
Fuyutsuki: So you’ll agree?
Gendo: Yes. But only out of curiosity. It would be interesting to see how their scenario has changed.
Fuyutsuki: Be careful. You can’t expect the city to work as a shield any longer . . .
Gendo: I believe it will last Long enough. . .
Fuyutsuki: (thinking) Long enough . . . until what?
Fuyutsuki: Oh . . .Miss Ibuki informs me that they’ve run into more difficulties with the Ev.N.
Gendo: Yes. It would appear she is suffering from the same hesitation as the previous project leader.
Fuyutsuki: What can you do? There isn’t anyone left who is skilled enough to continue the research.
Gendo: Perhaps. But all the necessary data is still there . . .
Fuyutsuki: So?
Gendo: So it is only a matter of time until the hour will come, and a replacement will be found.
Fuyutsuki: . . .
Gendo: And all that will remain of this foolish conflict will be memories.
Fuyutsuki: If there is anyone left here to have them . . .
-----------------------------------------------------------------------
Shinji: You’re sure you haven’t seen her?
Hikari: (over the phone) No. She left about 3:00 P.M. this afternoon.
Shinji: Okay . . .
Hikari: Ikari?
Shinji: Hmm?
Hikari: If you find her . . . call me?
Shinji: Yeah.
(With this, Shinji
Ikari presses ‘end’ on the small cellular phone in his palm. Sighing,
he folds it, setting
it down on the tabletop.)
Shinji: (thinking) I’m not the only one who runs away . . .
-----------------------------------------------------------------------
(sound of doorbell)
Lyn: Coming!
(Meanwhile. . . only 2 floors up . .
. Lyn Anouilh stands from his desk, where the week’s homework has
been laid out. The boy removes his reading glasses, setting them
gently on the table as he makes his way toward
the door . . .)
(As he pulls it open, he cannot help but have a smile on his face . . .)
Lyn: . . .
(This smile fades a little, however, upon seeing Aoi Tamashii standing there in a very forlorn state . . .)
Lyn: Hi . . .
Aoi: . . .
(The girl does not move as she stands there, her hands clasp together in front of her waist, as if waiting for something . . .)
(Shyly, Lyn lowers his eyes,)
Lyn: I . . I’m really glad that you came. I need someone to talk to—
(the boy stops in mid sentence, however, as
Aoi suddenly steps toward him—wrapping her arms tightly
under his shoulders, pulling herself close to him . . .
Anouilh steps back a bit, surprised by the
sudden gesture, before returning it—pulling his arms about her, hugging
her even closer . . .)
(inside the girl, a torrent of emotion—love mixed with sheer despair—ensnares her heart. With tears in her eyes, she embraces the boy, making not a sound, almost as if saying goodbye—
to the one that she truly loves . . .
before she eases away from him—
takes a step back,
raises her hand,
and slaps him full in the face. . .)
Lyn: . .!!!!!
Aoi: . . .
(The noise is a loud one—it echoes not unlike
a small thunderclap down the hallway and into the apartment:
A sharp ‘crack,’ followed by sudden, stinging pain . . .
A pain that has nothing to do with injury, however
. . .)
(Lyn’s eye’s widen in total disbelief, as
he brings his hand to the throbbing spot where her palm made
contact—his gaze remaining unfocused as the true reality of the situation
coldly and mercilessly dawns upon him.)
(All the while, Tamashii stands there, staring at him, as her hands ball into small fists . . .)
Aoi: . . .
(Finally, after an eternity of silence lasting a single moment, the boy finds the will to speak . . .)
Lyn: A . .Aoi . . ? Wh . . What—
Aoi: . . You . . Y-you lied to me. . .
Lyn: What are you talking about—
Aoi: I asked you if you loved me . . .
Lyn: But—I--
Aoi: You lied to me! YOU Never loved me!
Lyn: That’s not true—
Aoi: You lied to me, and then you . . . You raped me!
(Lyn’s eyes widen with horror--)
Lyn: . . .NO!
Aoi: All I wanted was for you to love me . . . all I wanted was you . . .
Lyn: Aoi!
Aoi: You just pretended . . . it was all a game, you were playing with me.
Lyn: . . .
Aoi: . . I wanted to be your friend!
Lyn: . . .
Aoi: I Just wanted to be your friend!! But now I know You’re too much of a coward to love me!
Lyn: Aoi! NO!
Aoi: I hate you, Lyn Anouilh. You’re a horrible coward, and I hate you. I hate you!
Lyn: . . . But . . .
Aoi: . . .
Lyn: But . . . I do . . I do love you!
(It is then, that Aoi freezes—staring at the boy as he makes this single, bold statement.
For an instant,
A part of her considers ending the sorrow,
a voice screaming inside her being, gazing at the sincerity in his eyes, begging her to cease . . .
. . but that voice, however, is quickly silenced . . .)
Aoi: . . N-no . .
(Slowly, the girl turns away from him—pressing her fist to her chest as her heart races within. . .)
Aoi: . . you don’t really love me.
Lyn: yes I do!
(It is then that Tamashii gasps—swallowing hard as she makes her final, terrible decision . . .)
Aoi: . . .boys learn to love from their mothers . . . but you are incapable of love—
Lyn: . . ?
Aoi: . . . because you killed your mother . . .
Lyn: . . .
(At these words, Lyn falls utterly silent—his
guts twisting into a cold, hard knot as his eyes fall to her back
in a vacant, shocked stare . . . )
Aoi: (thinking). . . no . . .
Lyn: . . . .
(Every movement is sheer agony as the girl turns to him, her hand still pressed to her heart . . .)
Aoi: I could never love a murderer.
Lyn: . . N . . . no . . .
(The boy’s voice is frail and weak as he answers
. . . an indication of just how deeply her words
cut into his fragile frame of mind . . .)
Aoi: I now know . . . I know what you thought of, when you first met me.
Lyn: w . . why . . ?
Aoi: You . . . imagined killing me. Just like her. Didn’t you?
Lyn: . . .
Aoi: You can do it now, if you wish.
Lyn: . . .
Aoi: I won’t stop you.
Lyn: . . .
Aoi: Because I have nothing more to live for.
(her entire body shivers as she says this; her fingers tightening, driving her nails into her palm, drawing blood.)
Lyn: . . . Get . .
Aoi: . . .
(The boy’s voice now no more than a whisper, he forces these final words to her . . .)
Lyn: (quietly) Get . . Get out.
(Tamashii makes no sound as she exits.
It is only after the door slides shut behind her, does Lyn know
that he is once more alone. . .
once more, truly, alone . . .)
-----------------------------------------------------------------------
Aoi: . . .
( As she steps out into the hallway, the door
to Lyn’s apartment closing behind her, the wall binding
Aoi’s resolve inexorably collapses—and the tears come forth, spilling
onto her hands as she covers her face,
running from the apartment.
As she rounds a corner, she slows, sliding
along the corridor as her sorrow overtakes her, causing her to
fall to her knees. For a moment, there is only her pain
at what she has done . . .
Then, Pushing her feelings deep down into the
dark hole that has formed inside her, the girl speaks to herself,
coldly, and inimically . . .)
Aoi: The . . 6th child is has been dealt with. . . and there is no need to further torment . . the seventh.
(Gathering what little strength remains for the tasks ahead, the girl wipes her eyes—at last standing once more.)
(It is without another word that she moves on . . . each step taking her farther and farther away from Lyn Anouilh . . .)
-----------------------------------------------------------------------
Tenkei: . . !?
(meanwhile, in the apartment two levels below . . .)
Tenkei: . . .
(Tenkei suddenly awakens from his nap before the TV set . . )
Tenkei: . . .
(his face is a picture of sheer confusion
as he looks about himself, bewildered at the sudden feeling
of coldness that has enveloped him.)
Tenkei: . . ?
(within seconds, however, the feeling passes—leaving as quickly as it had come . . .)
(Still, the boy stands—stepping toward the
kitchen, where Shinji sits, motionless, at the table.
The receiver of the portable telephone still in his hands, the child
has fallen asleep . . .)
Tenkei: . . .
(For a moment, he regards the EVA pilot—scrutinizing the boy as he sits there, dreaming . . .)
Tenkei: N . . not yet.
(And then, Tenkei turns, returning to his place in the living room.)
-----------------------------------------------------------------------
Gendo: It has . . been a while . . .
Kihl: . . . The promised time has come.
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Seele: . . .
Gendo: What makes you so certain?
Seele: That which you lost, is returned to us.
Kihl: Lancea Longini, that which will allow us to complete complementation
by Lilith, is ours once
again.
Fuyutsuki: So . . you wish a return to Seele’s scenario
Seele: Your plan has failed.
Seele: The causal chain which has wrought havoc upon us all.
Seele: yes, now, it will be broken.
Gendo: "broken?"
Seele: We shall journey the glorious Ark of Adam and Eva,
Seele: But only after separating ourselves from this mortal framework that imprisons us . . .
Seele: Nay, imprisons all of humanity.
Gendo: Humanity? And just how do you expect to accomplish this?
Seele: Our prophets, offering you deliverance 3 times . . .
Seele: Barakiel, the Lightning of God,
Seele: Neriah, the Lantern of God
Seele: Oriel, the light of God.
Kihl: You were offered a chance.
Fuyutsuki: (disgusted) A chance? To what? end it all?
Kihl: A chance that you foolishly refused!
Seele: It is only after your refusal that the Wrath of God was brought down upon you.
Seele: Rogziel,
Seele: Yet, you still use EVA unit 01. The living god we created . . .
Seele: A mistake swiftly rectified. . .
Seele: Man must not utilize this power!
Seele: So you were ordered.
Seele: And so you disobeyed.
Kihl: You were also aware of our scenario’s strengths, Ikari.
Gendo: And its weaknesses.
Kihl: Silence! You are not immune to infiltration.
No longer can you hide behind the city. Your human
Shield means
nothing to us.
Seele: Prepare yourself.
Seele: The right of passage, the fall of the barrier that
separates mankind from his final form, from our release,
is now all but gone.
Seele: Humanity has reached a deadlock – an impasse in his formation
that has
prevented him from achieving the state which he most desires.
Seele: Completion.
Fuyutsuki: What are you saying?
Seele: DEATH, Ikari.
Seele: Through death, mankind and the individual, shall become
one.
A new Advent, through man’s downfall.
Seele: Only through this shall we achieve rebirth. Rebirth as one.
Seele: . . As one consciousness.
Seele: Only through this.
Seele: The individual will cease to be a reality.
Seele: Many together, as one, shall find strength.
Seele: Only through death.
Kihl: From death, must come Resurrection.
Gendo: There is nothing to be gained from man’s death.
Seele: Know this: We promise you death.
Seele: Nay.
Kihl: We promise you Annihilation.
Seele: Ad Majorem Dei Glorium.
Seele: Pray, Ikari.
Seele: pray.
Seele: Nothing will save you.
(It is with these final words that all 12 monoliths
Vanish . . . leaving Gendo and Fuyutsuki with their thoughts echoing
throughout the empty chamber.)
-----------------------------------------------------------------------
(elsewhere . . .)
Rei: . . .
(In room 013, located in the department of the service hospital marked "1st Cranial Nerve". . . )
Rei: . . .
(Rei Ayanami, for a second time, awakens to find a foreign presence in the room.)
Rei: Who . . .
Aoi: Hello, Rei.
(Aoi sits on the open windowsill, overlooking
the vast Geofront beyond. The girl’s arms are folded, and her head
held low, as Rei sits up in bed, facing her. . .)
Aoi: It seems like a nice night out, doesn’t it?
(she pauses, sighing peacefully . . .)
Aoi: Of course, you can’t see any real stars down here . . .
Rei: . . .
(Rei faces the girl with patient eyes as a small breeze wafts in through the window, stirring her hair and cooling her pale skin . . .)
Aoi: But, in your case, I would suspect the moon means a lot more . . . right?
Rei: (quietly) Why are you doing this?
(Ayanami’s statement causes the other girl to halt entirely, and look at her in astonishment. . . then, Aoi relaxes, smiling to herself as she shakes her head . . .)
Aoi: I shouldn’t have tried to fool you. You already knew, anyway . . .
Rei: Yes . . .
(Sighing, Tamashii casts her gaze to the city lights illuminating the cavern outside . . .)
Aoi: How long have you known?
Rei: . . . Our trip to the market.
Aoi: . . .
Rei: You spoke like him.
(embarrassed, Aoi cannot help but laugh, in earnest, at herself . . .)
Aoi: . . . I should have realized some of Nagisa would rub off on me.
Rei: . . .
Aoi: But then, he was more like you than like me . . .
Rei: Unngh—
(The girl makes a small grunt as she slips
off the bed, steadying herself on the edge with slightly
trembling hands . . .)
Aoi: You really shouldn’t be getting up.
Rei: . . .
Aoi: But it is your decision, in any case . . .
(slowly, the girl turns her eyes back to the
window as Ayanami stands, bringing her to eye level from across
the room. . .)
Rei: Aoi . . .
Aoi: I’m sorry you had to feel such pain when the lance returned. I noticed its presence too . . .
(She pauses, looking back at Rei --)
Aoi: . . but not nearly so much as you.
Rei: . . .
Aoi: It is because you are linked to them—your bond to the Lilim means you must share their pain . . .
Rei: Lilim . .
Aoi: Yes.
Rei: Then you . . . you are . .
Aoi: I am of Adam, Rei.
Rei: . . .
(Rei looks down at her feet as another breeze picks up, ruffling the edges of her hospital gown . . .)
Aoi: I am also the 6th among you.
Rei: . . .I know. I have always known.
Aoi: But, then again, there are some things about you that I know . . .
Rei: . . .
Aoi: I know . . . that you remember.
Rei: . . .
Aoi: It was only a matter of time before the memories of your
past existence came back. They are etched
in the soul like lettering
on a tombstone, really.
Rei: . . .
Aoi: The only thing I am uncertain of, is when this became apparent to you.
Rei: A . . little while ago.
Aoi: But they are still not complete, are they?
Rei: . . .
aoi: Much like you . . .
(Suddenly, Tamashii laughs . . .)
Aoi: Perhaps we are more alike than I thought . . .
Rei: Aoi . . . what are you going to do . . ?
Aoi: Though my blood is red like yours . . my soul is blue . .
.
What I will do is
as inevitable as the tide . . .
(she pauses, sighing . . )
Aoi: Unfortunately, these days, even that is questionable.
Rei: . . .
Aoi: This is insanity, Rei.
Rei: . . ?
Aoi: Nothing more is sacred among these creatures.
Rei: Why . . do you say such things?
Aoi: Look at yourself. Look at The one called unit 06.
Rei: . . .
Aoi: Eva from Adam, Lilim from Lilith . . . and now Eva, Adamo,
and Lilith, together as one. It is
insane.
Rei: Unit 06?
Aoi: A creature I watched them create, using blood from Adam,
our mother being, and blood from Eva.
"Created from Adam’s rib."
The Lilim are nothing if not poetic.
Rei: . . .
Aoi: They ignore what is written, for their own good. Birthed
from Adam and Eva, will then come Able,
and eventually, Cain.
And Death will soon follow.
Rei: When It went berserk . . . And attacked us . . .
Aoi: That is just the beginning, Ayanami. Not even I am immune to what they have done.
Rei: You?
Aoi: Allying myself with Keel . . . his promise of freeing our
mother as hollow and empty as his
crystalline heart.
Rei: ‘Our?’
Aoi: Kowaru . . . Nagisa.
Rei: Why have you done this . . ?
Aoi: It is not by choice, Rei.
Rei: Why then, do you attack us?
(Aoi is quiet for a long time, apparently lost in thought as she considers the girl’s question . . .)
Aoi: There is no ‘why.’ Were our actions dictated by something
as trivial as intention, perhaps
I could change their
effect without accepting my own death.
Rei: . . .
Aoi: No, There is no ‘why’ or ‘how.’ Merely that we do it. To free Adam. And . . . destroy mankind.
Rei: I don’t believe you . . .
Aoi: . . . you know. . . You really should fear me . . .
Rei: . . .
(Strangely, the girl does not answer.
Instead, she turns to the inverted, sable skyline beyond,
smiling through tired eyes . . .)
Aoi: It truly is beautiful. What man has created.
Rei: . . .
Aoi: (Quietly) With it comes the price of his soul, I suppose . . .
Rei: Must it be this way?
Aoi: . . . I cannot say. All that I feel is that Eva unit 01 .
. . She is Lilith’s other . . .
a means to the end of all
ends. It makes me want to weep for you all.
Rei: I don’t believe that there is no other way . . . Humanity is--
Aoi: You tell me that this is what you believe . . . yet you doubt the
truth behind what you say as much as
any heathen would.
Why must I suffer you to live, then? And—if you are wrong, and what
you
believe is false,
why must I suffer the rest of humanity to live, then? Tell me, first
Child. . .The fate
of your species and mine
rests on your next breath.
Rei: . . .
(Both, in time, fall silent . . . considering each other in the trials that will come . . .
then--)
Aoi: I cannot do this to you . . . not yet.
Rei: . . . Do what?
Aoi: Please, Ayanami.
Rei: . . ?
Aoi: Forgive me.
Rei: . . .
Aoi: Forgive me on behalf of those two whom you are bonded.
Forgive me from your
own heart.
Rei: . .
Aoi: Forgive the terrible thing I must do . . .
Rei: (quietly) . . . I cannot.
Aoi: . . .
(Aoi nods, walking to the door of the hospital room.)
Aoi: . . . It is so beautiful. I wish It could last forever.
Like so many things . . .
unfortunately, It
too must end. . .
Rei: . . .
Aoi: Goodbye. I have to go now. . . I have other business to finish.
Rei: . . .
Aoi: From now on, please stay out of my way.
Rei: Why?
Aoi: because I sense that . . .When next we meet. . .
Rei: . . ?
(Oddly, Aoi gives her a sad smile)
Aoi: one of us will die.
Rei: . . .
Aoi: But, it will be a welcome release. . . right?
Rei: . . . No
Aoi: . . .
Rei: (thinking) You are a prisoner to what you do . . .
I am a prisoner to what I am . . .
-----------------------------------------------------------------------
Seyoko: Don’t be too hasty, now . . .
Misato: . . . ?
Seyoko: If you want, I can do it, if you get me past the security checkpoints—
Misato: No. There are things I have to see for myself.
(Meanwhile . . . In Misato Katsuragi’s car
as it speeds toward the Apartment complex both passengers
have come to call "home" . . .)
Seyoko: . . .
Misato: Tell me something.
Seyoko: . . . ?
Misato: What was Kaji like? To you?
Seyoko: You mean how did he act?
Misato: (nodding) . . .
Seyoko: . . . I don’t know . . . nice, I guess.
Misato: You mean he never—um. . .
(Seyoko, however, finishes Katsuragi’s sentence . . .)
Seyoko: Hit on me?
(The woman is cut off as Misato suddenly makes a sharp turn, a bit surprised . . .
Katsuragi laughs weakly, quickly apologizing . . )
Misato: Er . . sorry about that.
Seyoko: Yeah.
(Okazaki sighs, facing front--)
Seyoko: He never really did anything like that. He just
looked out for me because I was
the ‘little new girl.’
Misato: You sound disappointed . . .
Seyoko: Give me some credit, Major. I’m a woman, after all.
Misato: (thinking) yeah, barely . . .
Seyoko: Besides . . . You two had something together, right?
Misato: It was a long time ago. . .
Seyoko: It makes sense . . .
Misato: . . ?
Seyoko: He used to tell me . . . that there are some things in life worth dying for.
Misato: . . .
Seyoko: . . .
Misato: (quietly) things like the truth . . ?
Seyoko: Yes . . . .though I think he went a little far to prove the point . . .
Misato: Did you believe him?
Seyoko: No.
(Misato straightens out a bit, shaking her head . . .)
Misato: How can you be so cold?
Seyoko: In this business, it’s not a good idea to make ‘friends’. It will give you something to lose.
Misato: What about Anouilh. . . .
(Seyoko stops, apparently somewhat embarrassed. . . .)
Seyoko: Okay, you got me.
Misato: You said you’ve known him for a long time . . .
Seyoko: Yes . . . I used to live in London when I was little. I stayed there . . . for years at a time, actually.
Misato: . . sounds nice . . .
Seyoko: It was. I took care of him when he was younger . . . I was just a kid.
Misato: Not too many things have changed, I see.
(At this, Okazaki gives a weak laugh)
Seyoko: Maybe. After I got my assignment I just wanted to
keep an eye on him,
for his sake.
Misato: Why?
Seyoko: What do you mean? Because of the people I was investigating.
Misato: I don’t understand . . .
Seyoko: Hmmm?
Misato: what does your assignment to UNS have to do with Anouilh?
I mean, besides the fact that he’s a
pilot-
(Okazaki shakes her head . . )
Seyoko: Because of. . . the head of UNSynaps . .
Misato: . . . ?
( Oddly, Seyoko’s eyes narrow . . . )
Seyoko: He’s Lyn’s father.
(There is another sudden ‘screech’ as Misato slams the brakes . . .)
-----------------------------------------------------------------------
(Meanwhile, at the open door to Katsuragi’s home . . .)
Shinji: Um . . Where were you? I was getting . . .
(Ikari trails off, however, as Asuka steps by him, not even acknowledging his presence . . .)
Asuka: . . .
Shinji: Worried . . . uh . . .
Asuka: Schlaf jetzt Asuka, deine Mama ist hier . . .
Shinji: . . . ?
(It only with this quiet utterance that the girl goes into her room, shutting the door behind . . .)
-----------------------------------------------------------------------
(Much Later that night . . .
All has become quiet as the darkness of night has
finally descended fully on the household of Misato Katsuragi.
For the first time in a long while, All the residents of the
apartment are in their beds . . .
It will also be the last time, however . . .)
Shinji: ---
(In the modest, cramped confines of Shinji
Ikari’s room, the third child lies curled up on the stiff mattress
of the small bed next to the wall. His face is a mask of
languishing misery, his brow creased as indefinite, unnerving
visions flow from his subconsciousness. Every few moments, a
distressed whimper, quickened breathing, or a timorous
gasp breaks the silence . . .
. . and all of it, pure music to his tormentor . . .
in time, we see his thoughts . . .)
Shinji: No . . .
voice: Surely, you did not think she would care . . .
Shinji: Why not!?
(The scene is a dimly lit passenger train.
In one row of seats sits a likeness of Shinji Ikari, as he is seen through
the distorted lens of a troubled mind’s eye. Across from him,
obscured by a complex play of devious shadows and
piercing sunlight, a younger, smaller, more vacant version of that
same likeness sits, staring at his counterpart’s feet with
a wide-eyed, unending gaze. . .)
Chibi-Shinji: I must not deny what I know to be true, correct?
Shinji: I’m not denying anything!
Chibi-Shinji: But your very statement negates that which you
claim. You deny your own denial, denying
I, and therefore,
denying yourself.
Shinji: What are you talking about?
Chibi-Shinji: Don’t you see?
Shinji: . . .
Chibi-Shinji: I deny myself, denying my own happiness.
Shinji: But that’s stupid. Nobody does that on purpose!
Chibi-Shinji: Is it?
Shinji: . . .
Chibi-Shinji: I have the power to make myself happy. But I refuse that, based on my fear.
Shinji: Fear of what?
Chibi-Shinji: Fear of Pain.
Shinji: Pain?
Chibi-Shinji: you fear loving others, because you fear what may happen.
Shinji: r—Rejection?
Chibi-Shinji: No.
Shinji: What then?
Chibi-Shinji: Death.
Shinji: . . . !
Chibi-Shinji: I fear love for what has happened to those I love. The one who I called ‘friend . . ‘
Shinji: Touji . . .
Chibi-Shinji: Hurt because Of me. He and his sister, no less.
Shinji: . . .
Chibi-Shinji: Another. Asuka Soryu. Hurt because of who I am.
Shinji: Asuka . . .
Chibi-Shinji: Another: Rei Ayanami.
Shinji: . . .
Chibi-Shinji: Dead, because of her love for me.
Shinji: No . . .
Chibi-Shinji: Father.
Shinji: . . .
Chibi-Shinji: Loathes me, for what I am.
Shinji: . . .
Chibi-Shinji: Nagisa.
Shinji: . .!
Chibi-Shinji: Kowaru. The one who said "I love you." The one who truly cared for me.
Shinji: No!
Chibi-Shinji: The one who wished me to live, dying in my hands.
Shinji: . . .
Chibi-Shinji: but I fear love not for what it does to others, but for the pain you feel for myself!
Shinji: . . .
Chibi-Shinji: I am selfish, in my relationships with others, taking and never giving.
Shinji: but I tried to give!
Chibi-Shinji: Did I?
Shinji: . . .
Chibi-Shinji: Can I truly be happy this way? Alone? Perhaps, alone with only one? Is this the way?
Shinji: Why not?
Chibi Shinji: Because I lie to myself even then. That which I hold to be true, even now, is false. I deny.
Shinji: I don’t want to think about this any more!
Chibi Shinji: It hurts too much?
Shinji: Yes!
Chibi Shinji: Then . . . I dislike pain?
Shinji: Yes!
Chibi Shinji: But—This is one of the lies which I live. I deny.
Shinji: What?
Chibi Shinji: I do not dislike pain.
Shinji: . .???
Chibi Shinji: For I relish in the pain of others.
Shinji: Relish--?
Chibi Shinji: Love is Pain.
Shinji: . . .
Chibi Shinji: I enjoy the act. Therefore, I enjoy pain.
Shinji: That’s stupid! How can anyone like something that hurts them!?
Chibi-Shinji: Tell me then . . did he scream?
Shinji: . . what are you talking ab—
Chibi-Shinji: Nagisa . . . did he scream. . . when I killed him?
Shinji: . . .
Chibi-Shinji: It must have felt so terrible for me . . . to
see his life end . . . when I knew myself unworthy
to live. . .
Shinji: . . .
(all of a sudden, the child-Shinji’s face contorts into one of distorted rage—and, to Shinji Ikari’s mortified horror, the scene changes to one far more disturbing—
the traincar is abruptly replaced by the inside of Unit 01’s entry plug. Through the viewer before him, the walls of terminal dogma, obscured by a twisting, blazing inferno, can be seen . . . along with the hand of unit 01, who’s fingers are enclosed around the child version of the boy’s own introspective self . )
Chibi-Shinji: He loved you. Loved you enough to put his life in the palm of your hands.
Shinji: . . .
Chibi-Shinji: The hands of an insect that was given the power
of Adam. Yes, Lilim, I ask if you enjoyed
killing him!
Shinji: No . .No of course not!! But he was our enemy—that which attacks us--
Chibi-Shinji: How you must have told yourself, over and over,
that he was your enemy. That he deserved
death because he chose
it. How could you, when you cannot even shed a tear for him?
When you yourself are
not even worthy of living?
Shinji: I don’t want to hear any more!!!
(With this declaration, however, the EVA’s palm closes—crushing the boy in a vivid burst of red and gore, sending mangled, distorted pieces of the body falling to the ground far below . . . Ikari recoils in horror, then, as the child’s voice continues its pressing within the confines of a dream that has become a terrible reality . . . )
Chibi-Shinji: I will return to him soon. She . . . she
is the cause of all of this. In spawning that which
has taken him from us. She will pay.
Shinji: . . .
Chibi-Shinji: You will all be dead very soon, Lilim.
You were never worthy of Kaworu’s love. Never
worthy of his death. In this, you are not worthy of Asuka’s love.
. . You never will be.
-----------------------------------------------------------------------
(As Shinji’s body involuntarily shudders beneath
this ethereal torment, the feminine figure leaning over his bed
straightens, then stands, removing its hand from his forehead, which
is now covered in a cold sweat. With a quickened
sigh, she backs away from the boy, pressing the same hand to her own
chest. )
(As she exits his room , Aoi Tamashii’s form
can be seen in the moonlight streaming through the open windows.
With footsteps as silent as feathers on snow, the girl makes her way
back to the living room, where a familiar, stout little
shape stands watching, quietly . . .
gently, the girl pat’s the penguin on the head,
stroking the feathers above his avian brow . . . sighing quietly, she whispers
softly to the curious bird . . .)
Aoi: (gently) Sewing the seeds of discord is backbreaking work, Pen Pen. . .
Pen Pen: . . .
Aoi: Return to your rest now. it is very late . . .
Pen Pen: . . .
(The penguin, however, does not move, and instead
watches the girl as she steps through the kitchen,
then to the hallway, to exit through the door in which she came . .
.
What she finds waiting for her, however, is someone else altogether . . .)
Aoi: . . .
Tenkei: . . .
(Standing in the doorway directly before of
her, Tenkei looks up at the angelic figure with eyes that luminesce
eerily in the moonlight. . . the girl regards his determined face for
a moment, then shakes her head . . .)
Aoi: So, they now have a pure-bred Lilim among their ranks.
Tenkei: Anta’ ma-pas’ fe al baite!
Aoi: (disgusted) you think that dead tongue will do you
any good? Not many people these days speak the
language of the Sumarians, you know.
(Tenkei is taken aback for an instant, wide-eyed
in surprise at her response . . . but then, regaining his
composure, he speaks once more . . .)
Tenkei: You . . . you are not of her.
Aoi: Very good. Now run along . . . silly little boy.
Tenkei: You will not hurt them!
Aoi: You’re a little late.
Tenkei: . . .
(Suddenly, Aoi smiles, bending toward the small child with a wry
grin . . .)
Aoi: Hmm . . . I thought I sensed something familiar about you
. . .
Tenkei: . . .?
Aoi: Have you told them your secret? Do you think they will
treat you so kindly when they know what
you are?
Tenkei: You are one. One of six.
(Tamashii straightens, her face becoming serious . . .)
Aoi: They are four. Do not tempt me.
Tenkei: Al’ Mala'ika, Malachi. . . you cannot be tempted. You have no free will.
Aoi: (viscously) Be quiet!
Tenkei: . . .
Aoi: I will deal with you when I have the time.
Tenkei: . . .
(It is with this, That Tenkei steps out of
her way—allowing her to walk past. The Girl looks on
him no more as she walks toward the elevator—the child’s last words
already burning into her soul . . .)
-----------------------------------------------------------------------
(Meanwhile, two floors above . . .)
Seyoko: Lyn? What are you doing up?
Lyn: . . .
(Seyoko Okazaki has awakened to a cold midnight
breeze entering through the open doors of the
nearby balcony. As she sits up in her small futon, she
manages to catch a glimpse of Lyn through the now
billowing curtains as they are kicked up and tossed in the frigid wind.
. .)
Seyoko: Hey—Lyn?
Lyn: . . .
(Pulling away her bed-sheets, the girl comes
to her feet—sliding on a pair of slippers, and stepping
toward the unresponsive child . . .)
Seyoko: . . .
(As she makes her way onto the balcony, she finds him staring into the distance with widened, glazed-over eyes. . . )
Seyoko: Hey---Lyn!
Lyn: . . .NN. . .
Seyoko: . . . ?
(suddenly, a whimper comes from deep within
the boy’s throat—it is a pitiful sound, almost childlike in
nature. . . curiously, the girl follows his unending gaze, until she
finds the target of his meditative obsession . . .
The cross on a far-away church steeple . . .)
-----------------------------------------------------------------------
Lyn: -:-:-:-:-
Mara: You must . . .
child-Lyn: But I don’t want to! It’s bad!
Mara: Do what I say . . .
child-Lyn: But I don’t want you to die!!
Mara: We all must die some day, Lyn—
child-Lyn: But I don’t want to—
Mara: Don’t be a coward! Lyn!! Please!!!
child-Lyn: (crying) But I don’t want you to—
Mara: Lyn! If you love me!!
child-Lyn: (crying) Mama, no! Please mama! I promise I’ll be good! please no!
Mara: You have to!
child-Lyn: I love you mama! Please! Don’t make me be alone with him!
Mara: Shhhh . . . Do it now, Lyn. please.
child-Lyn: (sobbing)But I am Coward—I don’t want you to die!
Mara: Please . . .
child-Lyn: (crying) . . .but—the cross! He’s watching me!
Mara: Please . . . I want you with me when I die . .
child-Lyn: . . .
Mara: Please . . .
Lyn: . . . But . . the price of death is . . .
Mara: (softly) Please . . .
Seyoko: . . . ?
Lyn: (quietly) Nnn . . no,!!
Seyoko: . . .
(His voice, incredibly, is almost that of a
child many years younger . . . full of fear, much like the pale
expression now covering his face . . .)
Lyn: I . . I don’t want to . . . !!!
Seyoko: Lyn . . ?
Lyn: (whispering)Don’t make me. . .!
Seyoko: . . .
(It is then that, strangely, Seyoko’s face
falls—a faint sense of familiarity entering her mind, she closes her
eyes and, leaving the child where he is, returns to her place inside
the apartment . . .
Only this time, she pulls her hands over her ears . . .
if only to drown out the boy’s anguished pleas . . .)
-----------------------------------------------------------------------
Rei: -:-:-:-:-
They are so smooth . . .
So perfect . . .
And yet, in this, they are flawed . . .
like humans . . .
Incomplete . . .
I see now.
What my eyes can't see . . .
I see myself.
I see them.
I see him.
They are we . . .
the spheres.
Each with a purpose.
Each with a meaning.
Individual.
And as one.
Six.
Six.
I see,
Passions.
Joy . . .
Tenkei . . .
Sadness . . .
Ayanami
Anger . . .
Soryu
Desire . . .
Anouilh
Hatred . . .
Ikari.
And . . one other?
Yes.
It is regret.
Remorse.
It is all, as one.
I see you.
The last one.
One of them;
and one of us . . .
Deep . . blue.
You gave these to me.
My dreams . . .
You made me see.
I don’t . . .
I don’t know.
For she realizes that, after this night,
she will not dream again . . .)
-----------------------------------------------------------------------
(The next morning . . . in the small blue sports coup belonging to Misato Katsuragi . . .)
Misato: What’s wrong?
(The girl in the passenger seat leans wearily on the door, rubbing her tired eyes . . .)
Seyoko: Nothing.
Misato: Didn’t get much sleep last night, Lieutenant?
Seyoko: Let’s just do this, Ok?
Misato: That’s fine by me . . .
(Okazaki straightens in her seat, pulling at one edge of her loose fitting jacket . . .)
Seyoko: Unnh . . . You’ve still got my access card?
Misato: Yeah.
Seyoko: Do you understand what I told you to do? to get past the firewall?
Misato: I can handle it.
Seyoko: . . .fine by me. If you screw up, it’s your fault.
-----------------------------------------------------------------------
(Meanwhile, in the apartment several blocks behind . . .)
Shinji: . . .
(Shinji Ikari hurriedly packs a small bag—cloths,
money, and other immediate necessities—before heading
toward the door. Underneath a mask of depression, is an obvious
sense of desperation: an overwhelming desire
to get as far away as possible . . .
As he reaches the exit, however, he finds something barring his way . . .)
Shinji: . . .?
Tenkei: You can’t go!
(Ikari seems to ignore the child’s sudden clarity, though . . .)
Shinji: please—get out of my way.
(The child looks at him with pleading, yellow
eyes—but to no avail, as Shinji takes a surprisingly bold step
forward . . . finally, the boy’s look darkens, as a foreboding
sense of seriousness replaces his
saddened mien . . )
Tenkei: If they wish to hurt you, then you can run. But,
when you do so, you only delay your fate; you
will not be absolved of it.
Shinji: . . .
(Gritting his teeth, the young Ikari pushes
past the child, running down the hallway in the
direction of the stairs . . .)
Tenkei: . . .
(The small boy does not turn to watch after
him, however, as he goes. He merely lowers his eyes,
shaking his head . . .
Then, lifting his gaze, he sees something yet more unnerving . . .
for there, watching in a kind of wretched bewilderment, is Asuka Soryu. )
Tenkei: . . .?
(The boy quickly realizes that It is not Shinji whom she stares at, however . . .)
Asuka: . . .
Tenkei: . . .
(Tenkei immediately moves back—as Soryu begins
to take a small step toward him.
Without warning, the child turns—running out of the room as the entrance
closes at last. . .)
-----------------------------------------------------------------------
(The scene is nearly an hour later—beneath
the quiet chaos of the main control center . . .
Far below the main consoles, under the very base
of the Magus tower marked "Melchior," Misato Katsuragi sits,
a small keyboard marked "number 25" in hand.
With well practiced skill, the girl opens one of
the many access panels leading to the port to the machine’s innards.
Plugging in the large keypad, she kneels on the floor, floppy
-disk in hand, beginning the all-too-familiar process of gaining
access. . .
soon, a familiar screen greets Misato’s eyes . . .)
0031-427-03
WELCOME
MAJOR KATSURAGI
BETA LEVEL
CLEARANCE CONFIRMED
YOU HAVE
ENTERED-
DATA
ACCESS LEVEL ALPHA
(At once, she begins to type in the target of her searching . . .)
SECOND IMPACT_
-----------------------------------------------------------------------
Kihl: . . . Well?
UNS: All is ready.
Seele: . . . then when?
UNS: within the hour.
Kihl: Sacrifice is necessary. You understand this well, I assume.
UNS: . . . yes. For Seele’s scenario to come to fruition . . .
Seele: Then nothing more stands in our way . . .
-----------------------------------------------------------------------
Misato: So . . . this is the truth behind ‘the second impact’
(Misato squints coldly, a new pain twisting in her
abdomen as she reads the information onscreen.
it is then she clears the terminal, uttering once more to herself .
. .)
Misato: but. . . now only one thing remains . . .
(Quickly, She types in yet one more search string . . .)
Project Ev.N_
. . .
Classified
Data. Priority clearance required for access.
Misato: (thinking) This had better work, Kaji . . .
(With a deep breath, she stabs at the ‘enter’ key . . .
almost immediately, the information begins to scroll by . . .)
PROJECT Ev.N
HUMAN COMPLEMENTATION
Ev.N CANDIDATES:
1st CHILD:
AYANAMI, REI
STATUS:
ACTIVE
2ND CHILD:
SORYU, ASUKA
LANGLEY
STATUS: ACTIVE
3RD CHILD:
IKARI, SHINJI
STATUS: ACTIVE
4TH CHILD:
SUZIHARA, TOUJI
STATUS: INACTIVE
5TH CHILD:
KOWARU, NAGISA
STATUS: DECEASED
6TH CHILD:
DATA INCONCLUSIVE
STATUS: N/A
7TH CHILD:
ANOUILH, LYN
AARON
STATUS: STANDBY
CONTINUE? Y/N__
Misato: "Candidates?" to do what?
(The woman utters curiously under her breath as she hits the "y" key . . .)
Misato: Wh--What does this thing do . .?
(Seconds later, however, her question is answered . . .)
///// Ev.N PROTOTYPE
\\\\\
8002 EVA UNIT
07 SERIES
Misato: What!?
(The woman almost shouts with disbelief, leaning closer to her terminal screen . . .)
Ev.N A 114 COMPLEMENT
DESIGNATION:
‘TENKEI"
EVANGELION UNIT 07
(As Katsuragi looks on, her heart nearly stops—indeed, she comes to a cold, horrid understanding as her final encounter with Ritsuko Akagi rushes into her memories once more . . .)
Misato: The . .the thing’s an EVA?!
-(flashback)- Misato: The seventh? But --I thought you said Lyn was the seventh child-
-(flashback)- Ritsuko: You don't understand. Tenkei is Not one of the children. . .
-(flashback)- Ritsuko: Dammit, Misato, you're not listening! . . .he is factae de Adamo.
(Before she can go on, however, yet more data scrolls up the screen)
<Alternate
search strings:
Complement
unit "Tenkei"
Human/Eva
synchronization catalyst
Neural
interchange and harmonization carrier
Human/
Angel hybrid series 03>
- - - - - - - - - - - - -
Evangelion
Neural A 114 complement "Tenkei"
truncated
DNA sequence # 666 " GCATGCACGATGCTGACATCAG . . ."
(Genetic
component: Unknown male, John Doe, age approx. 31 years
Genetic
component: Being identified as "Lilith", age unknown
Genetic
component: Being identified as "ADAM", age unknown)
- - GENERAL
INFORMATION- - 
>>Human
Complementation, a projected 6 month program
incited
under the supervision of Commander Gendo Ikari and Dr. Ritsuko Akagi, seeking
to create
a safer
environment for Pilot/Evangelion synchronization, in both combat
and controlled
experimental scenarios. Utilizing techniques learned
during the
development of Evangelion Unit 06 [see "Project R" for more information]
,
Second phase
of the Human Complementation project
was incited
under the umbrella of the Human instrumentality program.
[See "Project
E" for more information] . The sole purpose: to better our
understanding
of the Harmonization
process, creating a more efficient defense system in the event
of Angel
assault.
(The woman sits back in her chair, attempting
to absorb what she is seeing . . . indeed, as the data stream finally
comes to a sudden halt, she feels her breathing quicken . . .)
Despite
the dismissal of the project chairperson,
further
development and testing continues.
-
-END ABSTRACT- -
Misato: (thinking) . . that’s it? There’s got to be more . . .
(despite Katsuragi’s further attempts at pressing further,
however, the computer screen merely reads: )
END GENERAL
INFORMATION
- - - -
- - - - - - - - -
EXTENDED
DATA CLASSIFIED LEVEL ALPHA-1R
PASSWORD
REQUIRED FOR ACCESS
PASSWORD:_
Misato: what now . . . ?
(gritting her teeth, Katsuragi keys in what first comes to mind . . .)
PASSWORD: C A T_
INVALID PASSWORD
I Error # 16
<Warning— 6 further attempts with failure to access will result in initiation of safety protocol #17>
Misato: . . . ?
(looking about herself, she tries again . . .)
PASSWORD: A D A M_
INVALID PASSWORD
I Error # 17
<Warning— 5 further attempts with failure to access will result in initiation of safety protocol #17>
PASSWORD: N A O K O_
INVALID PASSWORD
I Error # 18
<Warning— 4 further attempts with failure to access will result in initiation of safety protocol #17>
(As the 3rd error message appears onscreen, Misato bites her fingertip nervously . . .)
PASSWORD: R Y O U J I _
INVALID PASSWORD
I Error # 19
<Warning—
3 further attempts with failure to access will result in initiation of
safety protocol #17>
Misato: Dammit, Ritsuko! Why couldn’t you make this a little easier . . .
PASSWORD: I K A R I, Y O U I D I O T !_
INVALID PASSWORD
I Error # 19
<Warning—
2 further attempts with failure to access will result in initiation of
safety protocol #17>
(Having thoroughly racked her brain, Katsuragi
leans back in her seat—drumming her fingers absent-mindedly
against the edge of the console . . .)
Misato: (thinking). . . Why didn’t you tell me about the safeguards
. . . even Kaji’s chip can’t get into your
personal notes . . .!
( sighing, she closes her eyes . . . attempting to remember some aspect . . .
Indeed, some hint . . .
. . .of what lies in the deepest reaches of her friend’s troubled soul . . .)
Misato: It wouldn't be something anyone would know . . .
(defeated, she puts the keyboard down, leaning back against the terminal housing . . .)
Misato: (Thinking) . . . I wish you were here now, Ritchan . . .
(Then, suddenly, it hits . . .)
Misato: . . !
-(flashback)- Ritsuko: (shouting) Get back!!
-(flashback)- Misato: . . .
-(flashback)- Ritsuko: (panting) My life ended . . . when he put
Tenkei in the plug with Rei. He
used the boy as a weapon. With HER. He. . .HE KNEW what would
come of it! He promised me the child would be used to protect
the
pilots . . .To protect Shinji . . . The boy was my salvation!
-(flashback)- Misato: . . .
-(flashback)- Ritsuko: He . . . took my only chance for repentance
. . . and
turned it into my damnation . . .
-(flashback)-Ritsuko: . . . my only chance for repentance
Misato: It couldn’t be . . .
PASSWORD: R E P E N T A N C E_
.(suddenly, there is a high-pitched, confirmatory tone . . .)
CODE ACCEPTED . . .
PERSONAL NOTES
access :
Misato: . . .
(At once, the page fills with text. . . Misato's
eyes dart from left to right as she scans the massive
document, noting bits and pieces in her mind . . .)
- - - - - - - - - - - - - - - - - - - - - - - -
Day #16 . .
. We’ve finished sample collections from Eva 02, and from ‘Adam.’
I feel not unlike a modern day shaper, really . . .
although my
materials are as far from clay as they could be.
Angels aren’t made from clay, after all. Humans are.
Maya finally
admitted that she wasn’t too sure if she wanted to go along with this.
I told her not to worry—she can be so impressionable,
sometimes.
A flaw of youth, I suppose . . . or of innocence?
- - - - - - - - - - - - - - - - - - - - - - -
Day #
40 . . . Unit 06 accepted the grafts from Unit 01, just as I thought.
Maybe now we can turn it on without having it fall to pieces right in
front of us.
Gendo
seemed happy about the news. He seemed to care. I can’t believe
how pleased with myself I was . . . I have to remind myself that I am
being forced
to do this. I must be.
I found
Misato trying to get into the Magi’s mainframe today. I don’t know
what she is using to do it, but Balthazaar registered 8th level access.
Looks like
I have some backups to make . . .
- - - - - - - - - - - - - - - - - - - - - - - -
Day #
93 . . . I can’t believe how much he resembles him. . .It’s like
looking at a photograph from his childhood . . .I wonder what Misato
would say if
she saw him. She’d probably be more than willing to shoot me, I suppose.
For whatever reason, I’ve decided to alter his
appearance
a bit . . .
the final
component is well in place, now. the only coloring is a slight yellow tint
to the epidermal layers, due to the presence of blood vessels that carry
the LCL fluid
through his body. Besides this, I’ve noticed a near total lack of melanin
pigmentation in the skin, eyes, and hair: just like the previous
ones. . .
Funny,
it makes it seem like he’s missing something more . . .
I wonder if he knows who I am.
Should I expect him to have memories?
Or will he see me as his creator?
I have to remember where he comes from . . . what makes him who he is.
Misato
Invited me to lunch with her for the first time in a while. I wonder
if she’s forgiven me . . . Maybe I’ll have the strength to tell her .
Or maybe I’ll
just need to wait until I get drunk enough .
- - - - - - - - - - - - - - - - - - - - - - - -
I’ve decided to forgo the day, as I can no longer keep this record. Too much is happening
Commander
Ikari will betray me. I know it. I am of little use to him,
now. How disgusted I feel with myself, because I have always
known it;
because I realize that he never really lied to me in the first place .
. . it was all a delusion that I created. Just like mother.
It makes
me feel dirty, knowing WHO the child will interface with. I hate
myself even more. . . I’ve always known, in the back of my mind
. . .damn my
denial!!
It all
changes when I look at Tenkei. I see his innocence, and it fills
me with a sense of warmth I have never experienced before . . .
something different
from love, or joy . . .
I wonder . . . is this what it feels like to be a mother?
Maybe a part of you can read this and conceives my words, mom. I wonder what you would think of me. . . You’d probably laugh . . .
If , by some miracle, you are reading this Misato, then please understand what I’ve done.
He looks
at me and Maya, and seems to know something . . . as if there is a part
of him that retains the memories of his past life.
I think it
is possible. His purpose is to complete the incomplete. To make whole.
I truly believe this . . .
Because Every time I see him smile . . . I see Ryouji.
I wish
I could tell you now what I could never say to you in person.
The human component
of Tenkei . . . My retribution for all the pain, all the suffering.
Only someone
such as him could be a part of this . . . who would be willing to give,
to complete another . . .
Will you ever
know that I am sorry. . .
Misato: Oh, God, Ritsuko . . . how the hell could you!?
I am confident
now of what will happen. Unit 06’s re-activation trial is scheduled
for exactly 36 hours from now.
I already know
what the result will be . . . I can feel it in my bones.
I fear I have accepted it . . .
The Personality
transplant OS is fully functional. I never thought I would come to
this . . . I think It is only possible for me to do this now,
that I concieve
your motive fully, mom. I never knew TRUE creation before,
or the effect it would have. Maybe this is how God sees man.
As I see mysefl I know now that I can never be a mother. I cannot be so selfless.
But, I think I have begun to grasp the full meaning of it . . . enough that I regret not knowing sooner.
Now, at least, I can see me as I see you. I can understand these three aspects of you.
. . . As a scientist
. . . as a Woman . . . and now, in some way, as a mother.
Maybe even
better than you understood yourself.
Perhaps, this way, A part of me will live on. Like you. together.
Yet, another
part of me cannot help but wonder: If this was how it was meant to
be since the beginning.
Misato: Why didn’t you tell me!?!
(She drops the Keyboard onto the floor before her,
pounding her fist against the cold steel . . .)
Misato: It’s Kaji! That boy is KAJI!!!
(Suddenly--)
[Sys-op version 1.0]
/////-DELETE-/////
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
ERROR! ERROR!
ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR! ERROR!
ERROR!
CASPAR 666 ANTI-INFILTRATION COUNTERMEASURES INITIATED--
Misato: W-What—What’s going on!?
(Misato twists in her seat, grabbing the beretta from its place on the floor next to her--in one swift motion, she unlatches the safety, cocking the weapon as she stands--)
Misato: did they find me?
-----------------------------------------------------------------------
(Meanwhile, on the control area several tiers above . . . Alarm klaxons ring wildly as the emergency indicator signals red, lighting up the hexagonal alert map in an eerie scarlet glow . . . )
Hyuga: (shouting) 73, 042—the intrusion’s coming from the outside---I’m reading 4 separate signals!!
Fuyutsuki: Initiate second stage alert! What’s the status of the protection system?
Shigeru: The first stage of countermeasures have been breached—it’s
trying to access the security
mainframe inside the main installation!
Fuyutsuki: Where is the intruder coming from!?
Hyuga: I’ve got it---Sys-op’s traced it to –
(Suddenly, the man’s eyes widen . . .)
Fuyutsuki: Well!?
Hyuga: Sir--intruders Identified as Magi 2, 3 , 4, and 5!!
Fuyutsuki: What!?
Shigeru: The secondary Magi systems?!
Yuri: (shouting) Affirmative---I’ve traced signals to Germany, America, China --
Fuyutsuki: Forget the confirmation—we have to stop the intrusion!
Hyuga: The Caspar 666 program Dr. Akagi installed is tracking
them now—it looks like they are
coordinating their efforts—
(Growling, the sub-commander points to one of the secondary Nerv staff atop Balthazaar far below--)
Fuyutsuki: You—Get Matsushiro on the phone. Ask them just what is the meaning of this!
Staff: Yes sir--
Yuri: I’m reading intrusion in the main life support control nexus—9,768
shutdown attempts in the last
four seconds—
Shigeru: they’ve infiltrated the security barriers and are trying to get into the classified data--
Fuyutsuki: Prepare a complete shutdown of the input-output system. . .
Hyuga: right--
Shigeru: . . .
(Suddenly, Furikawa’s eye’s widen as they gaze down at the screen before her--)
Yuri: Wait—
Fuyutsuki: What is it?
Yuri: The program just kicked in---there’s massive feedback along
the communication network they set
up—
Hyuga: Affirmative--signals have been broken—
Fuyutsuki: Are we secure?
Shigeru: Caspar 666 is functioning. Intruders momentarily halted.
Fuyutsuki: Find Lieutenant Ibuki! Get her and her team on
this immediately! And Contact Major
Katsuragi!
Hyuga: Yes, sir--
Yuri: Sys-op reports 12.9% intrusion. All vital data is still untouched . . .
Fuyutsuki: Notify commander Ikari of the situation—Take us to first stage alert . . .!
Staff: sir! I’ve got the Tokyo 2 JSSDF chair on the phone!
Fuyutsuki: What’s going on—?
Staff: It’s not good . ..
-----------------------------------------------------------------------
(Moments later . . .)
Misato: They WHAT!?
Hyuga: (over the phone) The command division at Tokyo 2 announced a declaration A-801—
Misato: A 801!?
Hyuga: Yes—a total nullification of Nerv’s rights under the special
protection act with the United Nations,
and a complete transfer of our command structure to the Japanese government—
Misato: They’re trying to take over!?
Hyuga: Yes—It looks like their invasion of the Magi was just throwing down the gauntlet—
Misato: I’ll be right there—
Hyuga: Major, there’s one more thing—
Misato: . .. ?
Hyuga: (grimly) The declaration also includes an annulment of
the rights of all individuals within the immediate
vicinity of Nerv and Tokyo 3 . . . including any civilian and Military
personnel . . .
Misato: But---that’s practically declaring war!!
Hyuga: (quietly) That’s how it seems. . . ma’am, you have to bring the pilots!
(enraged, Misato slams the cellular phone shut, running through the empty hallway to the main lift area . . .)
Misato: (shouting) Son of a bitch!!
-----------------------------------------------------------------------
(Above . . . as the city pylons and skyscrapers once again lower into their emergency positions . . .)
Announcement: Attention. Attention. A special declaration
A-801 has been issued regarding all districts of Tokyo 3. All
nonvital personnel, evacuate to your assigned shelters IMMEDIATELY.
This is not a drill. Repeat, a special
declaration A-801 has been issued regarding all districts of Tokyo 3.
All nonvital personnel, evacuate to
your assigned shelters IMMEDIATELY. This is not a drill . . .
-----------------------------------------------------------------------
(Simultaneously . . .In the Apartment of Misato Katsuragi . . . )
Asuka: No . . . no . . .
-----------------------------------------------------------------------
(In the service Infirmary near the city’s interior . . . as buildings around it begin to lower into place . . .
. . we can see that Rei Ayanami’s hospital room lies empty . . .
While, strewn on the floor, the shattered, twisted
remains of Gendo Ikari's glasses glint in the morning
sunlight . . . )
-----------------------------------------------------------------------
(At the local school . . . a single, strong voice can be heard
above the panicked cries of dozens of students
as the sound of sirens echoes through the halls . .)
Hikari: Come on you guys!! You heard them—To the shelters, NOW!!!
Touji: . . .
(Next to Suzihara, Kensuke scratches the back of his head frantically . . . as if trying to remember . . .)
Kensuke: A-801 . . .A-801 . . . what was A-801 . . .??
(suddenly, the boy’s eyes widen in abject horror . . .)
Kensuke: (breathlessly). . . I don’t believe it . . .!!
Goro: . . .
-----------------------------------------------------------------------
Gendo: What is the status of the EVA series?
Hyuga: Repairs on Unit 01 are 90% complete. units 00 and 02 are all without pilots—
Gendo: Find them and have them brought to the cage immediately! By force, if necessary!
Hyuga: What about the sixth?
Gendo: He can take Rei’s place in unit 00! Now get to it!
Hyuga: Yes sir!
Shigeru: Sir! We’re receiving an automated distress call from the Mt. Fuji center!
Gendo: what’s happening?
Shigeru: It looks like they’re under attack!
Fuyutsuki: can you raise them?
Shigeru: Negative . . .!
Fuyutsuki: On screen!
(seconds later, a hazy, blurred image of the
familiar mountain appears on the fore wallscreen. Even from this
great distance, however, a thin, twisting pillar of smoke can be seen
rising from the location of the Observation center . . .
For a moment, the entire staff falls silent, as the full scope of their situation at last dawns mercilessly upon them all . . .)
Shigeru: It—it’s been completely destroyed!
(On the command platform above, Kouzou Fuyutsuki whispers to the man sitting in the seat before him . . .)
Fuyutsuki: . . . Ikari,
Gendo: Yes, I know.
(His grim demeanor now focused on the viewscreen before him, Commander Gendo Ikari utters but one thing, quietly . . .)
Gendo: The time . . . is now.
-----------------------------------------------------------------------
Preview:
Misato: Now, the end is at hand.
13 Demons, born of hell,
1, Born of heaven,
four horsemen,
six children,
10 circles of life.
A legion of darkness.
And one being, the key.
At last, The Instrumentality of man begins,
Only with his end.
For, with DEATH,
Must come RESURRECTION . . .
And only then,
will there be completion.
-----------------------------------------------------------------------
To Be Concluded . . .
